ornithine aminotransferase (OAT) (NM_001171814) Human Untagged Clone
CAT#: SC328490
OAT (untagged)-Human ornithine aminotransferase (OAT) transcript variant 2
CNY 6,270.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GACR; HOGA; OATASE; OKT |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001171814, the custom clone sequence may differ by one or more nucleotides
ATGAATACAGGAGTGGAGGCTGGAGAGACTGCCTGTAAACTAGCTCGTAAGTGGGGCTAT ACCGTGAAGGGCATTCAGAAATACAAAGCAAAGATTGTTTTTGCAGCTGGGAACTTCTGG GGTAGGACGTTGTCTGCTATCTCCAGTTCCACAGACCCAACCAGTTACGATGGTTTTGGA CCATTTATGCCGGGATTCGACATCATTCCCTATAATGATCTGCCCGCACTGGAGCGTGCT CTTCAGGATCCAAATGTGGCTGCGTTCATGGTAGAACCAATTCAGGGTGAAGCAGGCGTT GTTGTTCCGGATCCAGGTTACCTAATGGGAGTGCGAGAGCTCTGCACCAGGCACCAGGTT CTCTTTATTGCTGATGAAATACAGACAGGATTGGCCAGAACTGGTAGATGGCTGGCTGTT GATTATGAAAATGTCAGACCTGATATAGTCCTCCTTGGAAAGGCCCTTTCTGGGGGCTTA TACCCTGTGTCTGCAGTGCTGTGTGATGATGACATCATGCTGACCATTAAGCCAGGGGAG CATGGGTCCACATACGGTGGCAATCCACTAGGCTGCCGAGTGGCCATCGCAGCCCTTGAG GTTTTAGAAGAAGAAAACCTTGCTGAAAATGCAGACAAATTGGGCATTATCTTGAGAAAT GAACTCATGAAGCTACCTTCTGATGTTGTAACTGCCGTAAGAGGAAAAGGATTATTAAAC GCTATTGTCATTAAAGAAACCAAAGATTGGGATGCTTGGAAGGTGTGTCTACGACTTCGA GATAATGGACTTCTGGCCAAGCCAACCCATGGCGACATTATCAGGTTTGCGCCTCCGCTG GTGATCAAGGAGGATGAGCTTCGAGAGTCCATTGAAATTATTAACAAGACCATCTTGTCT TTCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001171814 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001171814.1, NP_001165285.1 |
RefSeq Size | 1874 bp |
RefSeq ORF | 906 bp |
Locus ID | 4942 |
UniProt ID | P04181 |
Protein Families | Druggable Genome |
Protein Pathways | Arginine and proline metabolism, Metabolic pathways |
Gene Summary | This gene encodes the mitochondrial enzyme ornithine aminotransferase, which is a key enzyme in the pathway that converts arginine and ornithine into the major excitatory and inhibitory neurotransmitters glutamate and GABA. Mutations that result in a deficiency of this enzyme cause the autosomal recessive eye disease Gyrate Atrophy. Alternatively spliced transcript variants encoding different isoforms have been described. Related pseudogenes have been defined on the X chromosome. [provided by RefSeq, Jan 2010] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229852 | OAT (Myc-DDK-tagged)-Human ornithine aminotransferase (OAT), transcript variant 2 |
CNY 4,370.00 |
|
RC229852L3 | Lenti-ORF clone of OAT (Myc-DDK-tagged)-Human ornithine aminotransferase (OAT), transcript variant 2 |
CNY 6,270.00 |
|
RC229852L4 | Lenti-ORF clone of OAT (mGFP-tagged)-Human ornithine aminotransferase (OAT), transcript variant 2 |
CNY 6,270.00 |
|
RG229852 | OAT (tGFP-tagged) - Human ornithine aminotransferase (OAT), transcript variant 2 |
CNY 4,850.00 |