KLHL7 (NM_001172428) Human Untagged Clone

CAT#: SC328258

KLHL7 (untagged)-Human kelch-like 7 (Drosophila) (KLHL7) transcript variant 3



  "NM_001172428" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-KLHL7 Antibody
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CISS3; KLHL6; PERCHING; SBBI26
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001172428, the custom clone sequence may differ by one or more nucleotides
ATGGCAGCCTCTGGGGTGGAGAAGAGCAGCAAGAAGAAGACCGAGAAGAAACTTGCTGCT
CGGGAAGAAGCTAAATTGTTGGCGGGTTTCATGGGCGTCATGAATAACATGCGGAAACAG
AAAACGTTGTGTGACGTGATCCTCATGGTCCAGGAAAGAAAGATACCTGCTCATCGTGTT
GTTCTTGCTGCAGCCAGTCATTTTTTTAACTTAATGTTCACAACTAACATGCTTGAATCA
AAGTCCTTTGAAGTAGAACTCAAAGATGCTGAACCTGATATTATTGAACAACTGGTGGAA
TTTGCTTATACTGCTAGAATTTCCGTGAATAGCAACAATGTTCAGTCTTTGCTGGATGCA
GCAAACCAATATCAGATTGAACCTGTGAAGAAAATGTGTGTTGATTTTTTGAAAGAACAA
GTTGATGCTTCAAATTGTCTTGGAGAAGCAGAAAAAGTTGATCAGAGCCTTCCAGAGTGT
GGTATGCTTTTCACTGTGTGA
Restriction Sites Please inquire     
ACCN NM_001172428
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001172428.1, NP_001165899.1
RefSeq Size 1032 bp
RefSeq ORF 501 bp
Locus ID 55975
UniProt ID Q8IXQ5
Gene Summary This gene encodes a BTB-Kelch-related protein. The encoded protein may be involved in protein degradation. Mutations in this gene have been associated with retinitis pigmentosa 42. [provided by RefSeq, Feb 2010]
Transcript Variant: This variant (3) differs in the 3' coding region and 3' UTR, compared to variant 1. The resulting isoform (3) has a distinct C-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...