United States
Germany
Japan
United Kingdom
China
MS4A7 (NM_021201) Human Untagged Clone
CAT＃: SC324533
MS4A7 (untagged)-Human membrane-spanning 4-domains, subfamily A, member 7 (MS4A7), transcript variant 1
CNY 2,400.00
CNY 2,950.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | 4SPAN2; CD20L4; CFFM4; MS4A8 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_021201.4
AAGATCGTTCTGGCAGGAACAGCCAGTGGGAGGTTCCAGCTGAGCGCTCCCCAGAGGTGA
GCTGATCCCCAGCCACAGCACACAGGACCAGGCTGCGAGAACAGCATCATCAGCATCATG CTATTACAATCCCAAACCATGGGGGTTTCTCACAGCTTTACACCAAAGGGCATCACTATC CCTCAAAGAGAGAAACCTGGACACATGTACCAAAACGAAGATTACCTGCAGAACGGGCTG CCAACAGAAACCACCGTTCTTGGGACTGTCCAGATCCTGTGTTGCCTGTTGATTTCAAGT CTGGGGGCCATCTTGGTTTTTGCTCCCTACCCCTCCCACTTCAATCCAGCAATTTCCACC ACTTTGATGTCTGGGTACCCATTTTTAGGAGCTCTGTGTTTTGGCATTACTGGATCCCTC TCAATTATCTCTGGAAAACAATCAACTAAGCCCTTTGACCTGAGCAGCTTGACCTCAAAT GCAGTGAGTTCTGTTACTGCAGGAGCAGGCCTCTTCCTCCTTGCTGACAGCATGGTAGCC CTGAGGACTGCCTCTCAACATTGTGGCTCAGAAATGGATTATCTATCCTCATTGCCTTAT TCGGAGTACTATTATCCAATATATGAAATCAAAGATTGTCTCCTGACCAGTGTCAGTTTA ACAGGTGTCCTAGTGGTGATGCTCATCTTCACTGTGCTGGAGCTCTTATTAGCTGCATAC AGTTCTGTCTTTTGGTGGAAACAGCTCTACTCCAACAACCCTGGGAGTTCATTTTCCTCG ACCCAGTCACAAGATCATATCCAACAGGTCAAAAAGAGTTCTTCACGGTCTTGGATATAA GTAACTCTTGGCCTCAGAGGAAGGAAAAGCAACTCAACACTCATGGTCAAGTGTGATTAG ACTTTCCTGAAATCTCTGCCATTTTAGATACTGTGAAACAAACTAAAAAAAAAAAAGCTT TTGTTCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_021201 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_021201.4, NP_067024.1 |
| RefSeq Size | 3024 bp |
| RefSeq ORF | 723 bp |
| Locus ID | 58475 |
| UniProt ID | Q9GZW8 |
| Domains | CD20 |
| Protein Families | Druggable Genome, Transmembrane |
| Gene Summary | This gene encodes a member of the membrane-spanning 4A gene family, members of which are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns in hematopoietic cells and nonlymphoid tissues. This family member is associated with mature cellular function in the monocytic lineage, and it may be a component of a receptor complex involved in signal transduction. This gene is localized to 11q12, in a cluster of other family members. At least four alternatively spliced transcript variants encoding two distinct isoforms have been observed. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longest transcript. It encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC204666 | MS4A7 (Myc-DDK-tagged)-Human membrane-spanning 4-domains, subfamily A, member 7 (MS4A7), transcript variant 1 |
CNY 2,400.00 |
|
| RC204666L1 | Lenti ORF clone of Human membrane-spanning 4-domains, subfamily A, member 7 (MS4A7), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC204666L2 | Lenti ORF clone of Human membrane-spanning 4-domains, subfamily A, member 7 (MS4A7), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RC204666L3 | Lenti ORF clone of Human membrane-spanning 4-domains, subfamily A, member 7 (MS4A7), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC204666L4 | Lenti ORF clone of Human membrane-spanning 4-domains, subfamily A, member 7 (MS4A7), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG204666 | MS4A7 (tGFP-tagged) - Human membrane-spanning 4-domains, subfamily A, member 7 (MS4A7), transcript variant 1 |
CNY 4,000.00 |
|
| SC127572 | MS4A7 (untagged)-Human membrane-spanning 4-domains, subfamily A, member 7 (MS4A7), transcript variant 1 |
CNY 2,400.00 |
