Peroxiredoxin 5 (PRDX5) (NM_012094) Human Untagged Clone
CAT#: SC322776
PRDX5 (untagged)-Human peroxiredoxin 5 (PRDX5), nuclear gene encoding mitochondrial protein, transcript variant 1
CNY 2,400.00
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ACR1; AOEB166; B166; HEL-S-55; PLP; PMP20; PRDX6; prx-V; PRXV; SBBI10 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_012094, the custom clone sequence may differ by one or more nucleotides
ATGGGACTAGCTGGCGTGTGCGCCCTGAGACGCTCAGCGGGCTATATACTCGTCGGTGGGGCCGGCGGTC AGTCTGCGGCAGCGGCAGCAAGACGGTGCAGTGAAGGAGAGTGGGCGTCTGGCGGGGTCCGCAGTTTCAG CAGAGCCGCTGCAGCCATGGCCCCAATCAAGGTGGGAGATGCCATCCCAGCAGTGGAGGTGTTTGAAGGG GAGCCAGGGAACAAGGTGAACCTGGCAGAGCTGTTCAAGGGCAAGAAGGGTGTGCTGTTTGGAGTTCCTG GGGCCTTCACCCCTGGATGTTCCAAGACACACCTGCCAGGGTTTGTGGAGCAGGCTGAGGCTCTGAAGGC CAAGGGAGTCCAGGTGGTGGCCTGTCTGAGTGTTAATGATGCCTTTGTGACTGGCGAGTGGGGCCGAGCC CACAAGGCGGAAGGCAAGGTTCGGCTCCTGGCTGATCCCACTGGGGCCTTTGGGAAGGAGACAGACTTAT TACTAGATGATTCGCTGGTGTCCATCTTTGGGAATCGACGTCTCAAGAGGTTCTCCATGGTGGTACAGGA TGGCATAGTGAAGGCCCTGAATGTGGAACCAGATGGCACAGGCCTCACCTGCAGCCTGGCACCCAATATC ATCTCACAGCTCTGA |
Restriction Sites | Please inquire |
ACCN | NM_012094 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_012094.3, NP_036226.1 |
RefSeq Size | 959 bp |
RefSeq ORF | 645 bp |
Locus ID | 25824 |
UniProt ID | P30044 |
Domains | AhpC-TSA |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein interacts with peroxisome receptor 1 and plays an antioxidant protective role in different tissues under normal conditions and during inflammatory processes. The use of alternate transcription start sites is thought to result in transcript variants that use different in-frame translational start codons to generate isoforms that are targeted to the mitochondrion (isoform L) or peroxisome/cytoplasm (isoform S). Multiple related pseudogenes have been defined for this gene. [provided by RefSeq, Nov 2017] Transcript Variant: This variant (1) represents the longest transcript, and encodes the longest isoform (L). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210709 | PRDX5 (Myc-DDK-tagged)-Human peroxiredoxin 5 (PRDX5), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 2,400.00 |
|
RC210709L1 | Lenti ORF clone of Human peroxiredoxin 5 (PRDX5), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC210709L2 | Lenti ORF clone of Human peroxiredoxin 5 (PRDX5), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC210709L3 | Lenti ORF clone of Human peroxiredoxin 5 (PRDX5), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC210709L4 | Lenti ORF clone of Human peroxiredoxin 5 (PRDX5), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
CNY 4,800.00 |
|
RG210709 | PRDX5 (tGFP-tagged) - Human peroxiredoxin 5 (PRDX5), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 4,000.00 |
|
SC111784 | PRDX5 (untagged)-Human peroxiredoxin 5 (PRDX5), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 2,400.00 |
其它Peroxiredoxin 5产品