Ska2 (NM_001009624) Rat Untagged Clone
CAT#: RN215228
Ska2 (untagged ORF) - Rat family with sequence similarity 33, member A (Fam33a), (10 ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Rat Untagged Clone |
Tag | Tag Free |
Synonyms | Fam33a; RGD1307084 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RN215228 representing NM_001009624
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGGCGGAGGTCGATAAGCTGGAACTGATGTTCCAGAAAGCTGATTCTGATTTGGATTACCTTCAGT ATAGGCTGGAATATGAAGTCAAGATTAATCACCCACACTCAGCAGGAGAGAAAAATGCAGTTGCAATTTT AAAAGAATTATCAGCAATAAAGTCTCGATATCAAGCTTTATGTGCACGCTTTAAGACAGTTTCTGTTGAG CAAAAAGAGACCAAGAGCTGCATTTGTGCTATTTTGAACAAGACAATGACCATGCTACAAGAACTACAGA AGCAAACAAACCTGGAGCTAACTCTGCTGACAGAAGAGGAGAAAGCTGTGACAGAGCGACTGAAGTCTCA CGTGCCAGACGTAGAGAACGGAATTTTACAAAGGAACTTTGATGGCGAAAAGATCAGCTCCAAAGAGATC CAGCGAGGTGTCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001009624 |
Insert Size | 435 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001009624.1, NP_001009624.1 |
RefSeq Size | 1214 bp |
RefSeq ORF | 435 bp |
Locus ID | 287598 |
UniProt ID | Q5I0J4 |
Gene Summary | Component of the SKA1 complex, a microtubule-binding subcomplex of the outer kinetochore that is essential for proper chromosome segregation. Required for timely anaphase onset during mitosis, when chromosomes undergo bipolar attachment on spindle microtubules leading to silencing of the spindle checkpoint. The SKA1 complex is a direct component of the kinetochore-microtubule interface and directly associates with microtubules as oligomeric assemblies. The complex facilitates the processive movement of microspheres along a microtubule in a depolymerization-coupled manner. In the complex, it is required for SKA1 localization. Affinity for microtubules is synergistically enhanced in the presence of the ndc-80 complex and may allow the ndc-80 complex to track depolymerizing microtubules.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RR215228 | Ska2 (Myc-DDK-tagged ORF) - Rat family with sequence similarity 33, member A (Fam33a), (10 ug) |
CNY 3,990.00 |
|
RR215228L3 | Lenti ORF clone of Ska2 (Myc-DDK-tagged ORF) - Rat family with sequence similarity 33, member A (Fam33a), (10 ug) |
CNY 6,080.00 |
|
RR215228L4 | Lenti ORF clone of Ska2 (mGFP-tagged ORF) - Rat family with sequence similarity 33, member A (Fam33a), (10 ug) |
CNY 6,650.00 |