Ska2 (NM_001009624) Rat Untagged Clone

CAT#: RN215228

Ska2 (untagged ORF) - Rat family with sequence similarity 33, member A (Fam33a), (10 ug)



  "NM_001009624" in other vectors (3)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms Fam33a; RGD1307084
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN215228 representing NM_001009624
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGGCGGAGGTCGATAAGCTGGAACTGATGTTCCAGAAAGCTGATTCTGATTTGGATTACCTTCAGT
ATAGGCTGGAATATGAAGTCAAGATTAATCACCCACACTCAGCAGGAGAGAAAAATGCAGTTGCAATTTT
AAAAGAATTATCAGCAATAAAGTCTCGATATCAAGCTTTATGTGCACGCTTTAAGACAGTTTCTGTTGAG
CAAAAAGAGACCAAGAGCTGCATTTGTGCTATTTTGAACAAGACAATGACCATGCTACAAGAACTACAGA
AGCAAACAAACCTGGAGCTAACTCTGCTGACAGAAGAGGAGAAAGCTGTGACAGAGCGACTGAAGTCTCA
CGTGCCAGACGTAGAGAACGGAATTTTACAAAGGAACTTTGATGGCGAAAAGATCAGCTCCAAAGAGATC
CAGCGAGGTGTCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001009624
Insert Size 435 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001009624.1, NP_001009624.1
RefSeq Size 1214 bp
RefSeq ORF 435 bp
Locus ID 287598
UniProt ID Q5I0J4
Gene Summary Component of the SKA1 complex, a microtubule-binding subcomplex of the outer kinetochore that is essential for proper chromosome segregation. Required for timely anaphase onset during mitosis, when chromosomes undergo bipolar attachment on spindle microtubules leading to silencing of the spindle checkpoint. The SKA1 complex is a direct component of the kinetochore-microtubule interface and directly associates with microtubules as oligomeric assemblies. The complex facilitates the processive movement of microspheres along a microtubule in a depolymerization-coupled manner. In the complex, it is required for SKA1 localization. Affinity for microtubules is synergistically enhanced in the presence of the ndc-80 complex and may allow the ndc-80 complex to track depolymerizing microtubules.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...