Decorin (DCN) (NM_133506) Human Tagged ORF Clone
CAT#: RG218427
- TrueORF®
DCN (tGFP-tagged) - Human decorin (DCN), transcript variant D
ORF Plasmid: DDK
"NM_133506" in other vectors (4)
Need custom modification / cloning service?
Get a free quote
CNY 4,370.00
CNY 1,000.00
Specifications
Product Data | |
Type | Human Tagged ORF Clone |
Tag | TurboGFP |
Synonyms | CSCD; DSPG2; PG40; PGII; PGS2; SLRR1B |
Vector | pCMV6-AC-GFP |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>RG218427 representing NM_133506
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGGCCACTATCATCCTCCTTCTGCTTGCACAAGTTTCCTGGGCTGGACCGTTTCAACAGAGAGGCT TATTTGACTTTATGCTAGAAGATGAGGCTTCTGGGATAGGCCCAGAAGTTCCTGATGACCGCGACTTCGA GCCCTCCCTAGGCCCAGTGTGCCCCTTCCGCTGTCAATGCCATCTTCGAGTGGTCCAGTGTTCTGATTTG GGTCTGGACAAAGTGCCAAAGGATCTTCCCCCTGACACAACTCTGCTAGACCTGCAAAACAACAAAATAA CCGAAATCAAAGATGGAGACTTTAAGAACCTGAAGAACCTTCACGTTGTCTACCTTCATAACAACAATAT CTCTGTAGTTGGATCAAGTGACTTCTGCCCACCTGGACACAACACCAAAAAGGCTTCTTATTCGGGTGTG AGTCTTTTCAGCAACCCGGTCCAGTACTGGGAGATACAGCCATCCACCTTCAGATGTGTCTACGTGCGCT CTGCCATTCAACTCGGAAACTATAAG ACGCGTACGCGGCCGCTCGAG - GFP Tag - GTTTAA |
Restriction Sites | SgfI-MluI Cloning Scheme for this gene Plasmid Map |
ACCN | NM_133506 |
ORF Size | 516 bp |
OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_133506.3 |
RefSeq Size | 1336 bp |
RefSeq ORF | 519 bp |
Locus ID | 1634 |
UniProt ID | P07585 |
Domains | LRRNT, LRR |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | TGF-beta signaling pathway |
Gene Summary | This gene encodes a member of the small leucine-rich proteoglycan family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protein. This protein plays a role in collagen fibril assembly. Binding of this protein to multiple cell surface receptors mediates its role in tumor suppression, including a stimulatory effect on autophagy and inflammation and an inhibitory effect on angiogenesis and tumorigenesis. This gene and the related gene biglycan are thought to be the result of a gene duplication. Mutations in this gene are associated with congenital stromal corneal dystrophy in human patients. [provided by RefSeq, Nov 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218427 | DCN (Myc-DDK-tagged)-Human decorin (DCN), transcript variant D |
CNY 3,990.00 |
|
RC218427L3 | Lenti ORF clone of Human decorin (DCN), transcript variant D, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC218427L4 | Lenti ORF clone of Human decorin (DCN), transcript variant D, mGFP tagged |
CNY 5,890.00 |
|
SC120507 | DCN (untagged)-Human decorin (DCN), transcript variant D |
CNY 2,400.00 |
其它Decorin产品