Ccdc167 (NM_001163741) Mouse Tagged ORF Clone
CAT#: MR221746
- TrueORF®
Ccdc167 (Myc-DDK-tagged) - Mouse RIKEN cDNA 1110021J02 gene (1110021J02Rik), transcript variant 1
ORF Plasmid: tGFP
"NM_001163741" in other vectors (4)
Need custom modification / cloning service?
Get a free quote
CNY 1,200.00
CNY 3,705.00
Cited in 1 publication. |
CNY 300.00
Specifications
Product Data | |
Type | Mouse Tagged ORF Clone |
Tag | Myc-DDK |
Synonyms | 1110021J02Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MR221746 representing NM_001163741
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGACTAAAAAGAAGCGGGAGAATCTTGGTGTCGCTCAGGAGATTGACGGGCTAGAGGAAAAGCTGTCCC GGTGTCGGAAGGACCTGGAGGCCGTGACCTCCCAGCTTTACAGGGCAGAGCTCAGTCCTGAGGACAGGAG GTCTCTGGAGAAGGAGAAACACACCCTCATGAACAAAGCCTCCAAGTATGAGAAAGAGCTAAAGCTGCTT CGACATGAGAACCGGAAGAACACGCTCCTCTCGGTGGCCATCTTCACTGTCTTCGCCCTGCTCTATGCTT ACTGGACTATCCGATACACCTCCTTCACCCTG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI Cloning Scheme for this gene Plasmid Map |
ACCN | NM_001163741 |
ORF Size | 312 bp |
OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001163741.2, NP_001157213.1 |
RefSeq Size | 4625 bp |
RefSeq ORF | 315 bp |
Locus ID | 68597 |
UniProt ID | Q9D162 |
MW | 12.8 kDa |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Identification of new transmembrane proteins concentrated at the nuclear envelope using organellar proteomics of mesenchymal cells
,Cheng, L;Baboo, S;Lindsay, C;Brusman, L;Martinez-Bartolome, S;Tapia, O;Zhang, X;Yates, J;Gerace, L;,
bioRxiv
[CCDC167]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC210757 | Ccdc167 (untagged) - Mouse RIKEN cDNA 1110021J02 gene (1110021J02Rik), transcript variant 1, (10ug) |
CNY 3,990.00 |
|
MG221746 | Ccdc167 (tGFP-tagged) - Mouse RIKEN cDNA 1110021J02 gene (1110021J02Rik) transcript variant 1, (10ug) |
CNY 2,850.00 |
|
MR221746L3 | Lenti ORF clone of Ccdc167 (Myc-DDK-tagged) - Mouse RIKEN cDNA 1110021J02 gene (1110021J02Rik), transcript variant 1 |
CNY 4,750.00 |
|
MR221746L4 | Lenti ORF clone of Ccdc167 (mGFP-tagged) - Mouse RIKEN cDNA 1110021J02 gene (1110021J02Rik), transcript variant 1 |
CNY 4,750.00 |
其它Ccdc167产品