Ins2 (NM_001185083) Mouse Untagged Clone
CAT#: MC208792
Ins2 (untagged) - Mouse insulin II (Ins2), transcript variant 1, (10ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AA986540; In; Ins-2; InsII; Mod; Mody; Mody4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208792 representing NM_001185083
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCCTGTGGATGCGCTTCCTGCCCCTGCTGGCCCTGCTCTTCCTCTGGGAGTCCCACCCCACCCAGG CTTTTGTCAAGCAGCACCTTTGTGGTTCCCACCTGGTGGAGGCTCTCTACCTGGTGTGTGGGGAGCGTGG CTTCTTCTACACACCCATGTCCCGCCGTGAAGTGGAGGACCCACAAGTGGCACAACTGGAGCTGGGTGGA GGCCCGGGAGCAGGTGACCTTCAGACCTTGGCACTGGAGGTGGCCCAGCAGAAGCGTGGCATTGTAGATC AGTGCTGCACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001185083 |
Insert Size | 333 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001185083.2, NP_001172012.1 |
RefSeq Size | 473 bp |
RefSeq ORF | 333 bp |
Locus ID | 16334 |
UniProt ID | P01326 |
Gene Summary | This gene encodes insulin, a peptide hormone that plays a vital role in the regulation of carbohydrate and lipid metabolism. The encoded precursor protein undergoes proteolytic cleavage to produce a disulfide-linked heterodimeric functional protein that is stored in secretory granules. An increase in blood glucose levels, among others, induces the release of insulin from the secretory granules. Mice deficient in the functional hormone encoded by this gene develop diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015] Transcript Variant: This variant (1) represents the shortest transcript. Variants 1-3 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226647 | Ins2 (tGFP-tagged) - Mouse insulin II (Ins2) transcript variant 1, (10ug) |
CNY 2,800.00 |
|
MR226647 | Ins2 (Myc-DDK-tagged) - Mouse insulin II (Ins2), transcript variant 1 |
CNY 1,200.00 |
|
MR226647L3 | Lenti ORF clone of Ins2 (Myc-DDK-tagged) - Mouse insulin II (Ins2), transcript variant 1 |
CNY 4,750.00 |
|
MR226647L4 | Lenti ORF clone of Ins2 (mGFP-tagged) - Mouse insulin II (Ins2), transcript variant 1 |
CNY 4,750.00 |