IDI1 (NM_004508) Human Untagged Clone

CAT#: SC317411

IDI1 (untagged)-Human isopentenyl-diphosphate delta isomerase 1 (IDI1)



  "NM_004508" in other vectors (7)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal antibody to IDI1 (isopentenyl-diphosphate delta isomerase 1)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms IPP1; IPPI1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317411 representing NM_004508.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTGGCGTGGACTGGCGCTGGCGCGAGCGATTGGCTGCGCGGCCCGGGGGCGGGGCCAGTGGGCGGTG
CGCGCCGCAGACTGTGCTCAAAGCGGGCGCCATCCGGGACCGGCGGTTGTCTGTGGCCGGAGGCTGATC
AGTGTTCTAGAACAGATCAGACATTTTGTAATGATGCCTGAAATAAACACTAACCACCTCGACAAGCAA
CAGGTTCAACTCCTGGCAGAGATGTGTATCCTTATTGATGAAAATGACAATAAAATTGGAGCTGAGACC
AAGAAGAATTGTCACCTGAACGAGAACATTGAGAAAGGATTATTGCATCGAGCTTTTAGTGTCTTCTTA
TTCAACACCGAAAATAAGCTTCTGCTACAGCAAAGATCAGATGCTAAGATTACCTTTCCAGGTTGTTTT
ACGAATACGTGTTGTAGTCATCCATTAAGCAATCCAGCCGAGCTTGAGGAAAGTGACGCCCTTGGAGTG
AGGCGAGCAGCACAGAGACGGCTGAAAGCTGAGCTAGGAATTCCCTTGGAAGAGGTTCCTCCAGAAGAA
ATTAATTATTTAACACGAATTCACTACAAAGCTCAGTCTGATGGTATCTGGGGTGAACATGAAATTGAT
TACATTTTGTTGGTGAGGAAGAATGTAACTTTGAATCCAGATCCCAATGAGATTAAAAGCTATTGTTAT
GTGTCAAAGGAAGAACTAAAAGAACTTCTGAAAAAAGCAGCCAGTGGTGAAATTAAGATAACGCCATGG
TTTAAAATTATTGCAGCGACTTTTCTCTTTAAATGGTGGGATAACTTAAATCATTTGAATCAGTTTGTT
GACCATGAGAAAATATACAGAATGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_004508
Insert Size 855 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004508.3
RefSeq Size 2996 bp
RefSeq ORF 855 bp
Locus ID 3422
UniProt ID Q13907
Domains NUDIX
Protein Pathways Metabolic pathways, Terpenoid backbone biosynthesis
MW 32.5 kDa
Gene Summary IDI1 encodes a peroxisomally-localized enzyme that catalyzes the interconversion of isopentenyl diphosphate (IPP) to its highly electrophilic isomer, dimethylallyl diphosphate (DMAPP), which are the substrates for the successive reaction that results in the synthesis of farnesyl diphosphate and, ultimately, cholesterol. It has been shown in peroxisomal deficiency diseases such as Zellweger syndrome and neonatal adrenoleukodystrophy that there is reduction in IPP isomerase activity. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes the longest isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...