CYP39A1 (NM_001278739) Human Untagged Clone

CAT#: SC335167

CYP39A1 (untagged) - Human cytochrome P450, family 39, subfamily A, polypeptide 1 (CYP39A1), transcript variant 3



  "NM_001278739" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CYP39A1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335167 representing NM_001278739.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTCTTTAATAAAAGTTTGTTTTCCACAAACAAGAAAAAAATCAAGGAGTTCCATCAGTATTTTCAA
GTTTATGATGAAGATTTTGAGTATGGGTCCCAGTTGCCAGAGTGTCTTCTAAGAAACTGGTCAAAATCC
AAAAAGTGGTTCCTGGAACTGTTTGAGAAAAACATTCCAGATATAAAAGCATGTAAATCTGCAAAAGAT
AATTCCATGACATTATTGCAAGCTACGCTGGATATTGTAGAGACGGAAACAAGTAAGGAAAACTCACCC
AATTATGGGCTCTTACTGCTTTGGGCTTCTCTGTCTAATGCTGTTCCTGTTGCATTTTGGACACTTGCA
TACGTCCTTTCTCATCCTGATATCCACAAGGCCATTATGGAAGGCATATCTTCTGTGTTTGGCAAAGCA
GGCAAAGATAAGATTAAAGTGTCTGAGGATGACCTGGAGAATCTCCTTCTAATTAAATGGTGTGTTTTG
GAAACCATTCGTTTAAAAGCTCCTGGTGTCATTACTAGAAAAGTGGTGAAGCCTGTGGAAATTTTGAAT
TACATCATTCCTTCTGGTGACTTGTTGATGTTGTCTCCATTTTGGCTGCATAGAAATCCAAAGTATTTT
CCTGAGCCTGAATTGTTCAAACCTGAACGTTGGAAAAAGGCAAATTTAGAGAAGCACTCTTTCTTGGAC
TGCTTCATGGCATTTGGAAGCGGGAAGTTCCAGTGTCCTGCAAGGTGGTTTGCTCTGTTAGAGGTTCAG
ATGTGTATTATTTTAATACTTTATAAATATGACTGTAGTCTTCTGGACCCATTACCCAAACAGAGTTAT
CTCCATTTGGTGGGTGTCCCCCAGCCGGAAGGGCAATGCCGAATTGAATATAAACAAAGAATATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278739
Insert Size 894 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278739.1
RefSeq Size 2269 bp
RefSeq ORF 894 bp
Locus ID 51302
UniProt ID Q9NYL5
Protein Families Druggable Genome, P450, Transmembrane
Protein Pathways Primary bile acid biosynthesis
MW 34.5 kDa
Gene Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein is involved in the conversion of cholesterol to bile acids. Its substrates include the oxysterols 25-hydroxycholesterol, 27-hydroxycholesterol and 24-hydroxycholesterol. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (3) differs in its 5' UTR and uses a downstream start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...