G protein alpha Inhibitor 2 (GNAI2) (NM_001282618) Human Untagged Clone
CAT#: SC334976
GNAI2 (untagged) - Human guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 (GNAI2), transcript variant 4
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GIP; GNAI2B; H_LUCA15.1; H_LUCA16.1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282618, the custom clone sequence may differ by one or more nucleotides
ATGGCCATTGTCAAAGCCATGGGCAACCTGCAGATCGACTTTGCCGACCCCTCCAGAGCGGACGACGCCA GGCAGCTATTTGCACTGTCCTGCACCGCCGAGGAGCAAGGCGTGCTCCCTGATGACCTGTCCGGCGTCAT CCGGAGGCTCTGGGCTGACCATGGTGTGCAGGCCTGCTTTGGCCGCTCAAGGGAATACCAGCTCAACGAC TCAGCTGCCTACTACCTGAACGACCTGGAGCGTATTGCACAGAGTGACTACATCCCCACACAGCAAGATG TGCTACGGACCCGCGTAAAGACCACGGGGATCGTGGAGACACACTTCACCTTCAAGGACCTACACTTCAA GATGTTTGATGTGGGTGGTCAGCGGTCTGAGCGGAAGAAGTGGATCCACTGCTTTGAGGGCGTCACAGCC ATCATCTTCTGCGTAGCCTTGAGCGCCTATGACTTGGTGCTAGCTGAGGACGAGGAGATGAACCGCATGC ATGAGAGCATGAAGCTATTCGATAGCATCTGCAACAACAAGTGGTTCACAGACACGTCCATCATCCTCTT CCTCAACAAGAAGGACCTGTTTGAGGAGAAGATCACACACAGTCCCCTGACCATCTGCTTCCCTGAGTAC ACAGGGGCCAACAAATATGATGAGGCAGCCAGCTACATCCAGAGTAAGTTTGAGGACCTGAATAAGCGCA AAGACACCAAGGAGATCTACACGCACTTCACGTGCGCCACCGACACCAAGAACGTGCAGTTCGTGTTTGA CGCCGTCACCGATGTCATCATCAAGAACAACCTGAAGGACTGCGGCCTCTTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282618 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001282618.1, NP_001269547.1 |
RefSeq Size | 2215 bp |
RefSeq ORF | 825 bp |
Locus ID | 2771 |
UniProt ID | P04899 |
Protein Families | Druggable Genome |
Protein Pathways | Axon guidance, Chemokine signaling pathway, Gap junction, Leukocyte transendothelial migration, Long-term depression, Melanogenesis, Progesterone-mediated oocyte maturation, Tight junction |
Gene Summary | The protein encoded by this gene is an alpha subunit of guanine nucleotide binding proteins (G proteins). The encoded protein contains the guanine nucleotide binding site and is involved in the hormonal regulation of adenylate cyclase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013] Transcript Variant: This variant (4) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (4) is shorter at the N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237082 | GNAI2 (myc-DDK-tagged) - Human guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 (GNAI2), transcript variant 4 |
CNY 3,990.00 |
|
RG237082 | GNAI2 (tGFP-tagged) - Human guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 (GNAI2), transcript variant 4 |
CNY 4,370.00 |