p21 ARC (ARPC3) (NM_001287222) Human Untagged Clone

CAT#: SC334195

ARPC3 (untagged) - Human actin related protein 2/3 complex, subunit 3, 21kDa (ARPC3), transcript variant 2



  "NM_001287222" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
ARPC3 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARC21; p21-Arc
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001287222, the custom clone sequence may differ by one or more nucleotides


ATGCCGGCTTACCACTCTTCTCTCATGGATCCTGATACCAAACTCATCGGAAACATGGCACTGTTGCCTA
TCAGAAGTCAATTCAAAGGACCTGCCCCCAGAGAGACAAAAGATACAGATATTGTGGATGAAGCCATCTA
TTACTTCAAGGCCAATGTCTTCTTCAAAAACTATGAAATTAAGAATGAAGCTGATAGGACCTTGATATAT
ATAACTCTCTACATTTCTGAATGTCTGAAGAAACTGCAAAAGTGCAATTCCAAAAGCCAAGGTGAGAAAG
AAATGTATACGCTGGGAATCACTAATTTTCCCATTCCTGGAGAGCCTGGTTTTCCACTTAACGCAATTTA
TGCCAAACCTGCAAACAAACAGGAAGATGTGATGAGAGCCTATTTACAACAGCTAAGGCAAGAGACTGGA
CTGAGACTTTGTGAGAAAGTTTTCGACCCTCAGAATGATAAACCCAGCAAGTGGTGGACTTGCTTTGTGA
AGAGACAGTTCATGAACAAGAGTCTTTCAGGACCTGGACAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001287222
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001287222.1, NP_001274151.1
RefSeq Size 959 bp
RefSeq ORF 534 bp
Locus ID 10094
UniProt ID O15145
Protein Pathways Fc gamma R-mediated phagocytosis, Pathogenic Escherichia coli infection, Regulation of actin cytoskeleton
Gene Summary This gene encodes one of seven subunits of the human Arp2/3 protein complex. The Arp2/3 protein complex has been conserved through evolution and is implicated in the control of actin polymerization in cells. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (2) uses an alternate in-frame acceptor splice site in the 3' coding region compared to variant 1. The resulting shorter isoform (2) lacks 1 aa compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...