NMNAT1 (NM_001297779) Human Untagged Clone

CAT#: SC334069

NMNAT1 (untagged) - Human nicotinamide nucleotide adenylyltransferase 1 (NMNAT1), transcript variant 3



  "NM_001297779" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


NMNAT1 mouse monoclonal antibody, clone OTI1G4 (formerly 1G4)
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms LCA9; NMNAT; PNAT1; SHILCA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334069 representing NM_001297779.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAAAATTCCGAGAAGACTGAAGTGGTTCTCCTTGCTTGTGGTTCATTCAATCCCATCACCAACATG
CACCTCAGGTTGTTTGAGCTGGCCAAGGACTACATGAATGGAACAGGAAGGTACACAGTTGTCAAAGGC
ATCATCTCTCCTGTTGGTGATGCCTACAAGAAGAAAGGACTCATTCCTGCCTATCACCGGGTCATCATG
GCAGAACTTGCTACCAAGAATTCTAAATGGGTGGAAGTTGATACATGGGAAAGTCTTCAGAAGGAGTGG
AAAGAGACTCTGAAGGTGCTAAGACACCATCAAGAGAAATTGGAGGCTAGTGACTGTGATCACCAGCAG
AACTCACCTACTCTAGAAAGGCCTGGAAGGAAGAGGAAGTGGACTGAAACACAAGATTCTAGTCAAAAG
AAATCCCTAGAGCCAAAAACAAAAGATGGAGTCTCGCTCTATCACCCAGGCTGGAGTGCAGTGGCATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001297779
Insert Size 483 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001297779.1
RefSeq Size 1100 bp
RefSeq ORF 483 bp
Locus ID 64802
Protein Pathways Metabolic pathways, Nicotinate and nicotinamide metabolism
MW 18.3 kDa
Gene Summary This gene encodes an enzyme which catalyzes a key step in the biosynthesis of nicotinamide adenine dinucleotide (NAD). The encoded enzyme is one of several nicotinamide nucleotide adenylyltransferases, and is specifically localized to the cell nucleus. Activity of this protein leads to the activation of a nuclear deacetylase that functions in the protection of damaged neurons. Mutations in this gene have been associated with Leber congenital amaurosis 9. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene are located on chromosomes 1, 3, 4, 14, and 15. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (3) lacks an exon and contains an alternate 3' terminal exon, resulting in a different 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...