CAPNS1 (NM_001302633) Human Untagged Clone

CAT#: SC334022

CAPNS1 (untagged) - Human calpain, small subunit 1 (CAPNS1), transcript variant 4



  "NM_001302633" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-CAPNS1 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CALPAIN4; CANP; CANPS; CAPN4; CDPS; CSS1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334022 representing NM_001302633.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGGTCAGCGCCACAGAACTCATGAACATTCTCAATAAGGTTGTGACACGACACCCTGATCTGAAG
ACTGATGGTTTTGGCATTGACACATGTCGCAGCATGGTGGCCGTGATGGATAGCGACACCACAGGCAAG
CTGGGCTTTGAGGAATTCAAGTACTTGTGGAACAACATCAAAAGGTGGCAGGCCATATACAAACAGTTC
GACACTGACCGATCAGGGACCATTTGCAGTAGTGAACTCCCAGGTGCCTTTGAGGCAGCAGGGTTCCAC
CTGAATGAGCATCTCTATAACATGATCATCCGACGCTACTCAGATGAAAGTGGGAACATGGATTTTGAC
AACTTCATCAGCTGCTTGGTCAGGCTGGACGCCATGTTCCGTGCCTTCAAATCTCTTGACAAAGATGGC
ACTGGACAAATCCAGGTGAACATCCAGGAGTGGCTGCAGCTGACTATGTATTCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001302633
Insert Size 471 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001302633.1
RefSeq Size 1271 bp
RefSeq ORF 471 bp
Locus ID 826
UniProt ID P04632
Protein Families Druggable Genome, Protease
MW 18 kDa
Gene Summary This gene is a member of the calpain small subunit family. Calpains are calcium-dependent cysteine proteinases that are widely distributed in mammalian cells. Calpains operate as heterodimers, comprising a specific large catalytic subunit (calpain 1 subunit in Calpain I, and calpain 2 subunit in Calpain II), and a common small regulatory subunit encoded by this gene. This encoded protein is essential for the stability and function of both calpain heterodimers, whose proteolytic activities influence various cellular functions including apoptosis, proliferation, migration, adhesion, and autophagy. Calpains have been implicated in neurodegenerative processes, such as myotonic dystrophy. A pseudogene of this gene has been defined on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Transcript Variant: This variant (4) lacks two 5' exons and uses an alternate 5' terminal exon which results in the use of a downstream in-frame start codon, compared to variant 1. It encodes isoform 2 which has a shorter N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...