Nectin 3 (NECTIN3) (NM_001243286) Human Untagged Clone

CAT#: SC331988

PVRL3 (untagged) - Homo sapiens poliovirus receptor-related 3 (PVRL3), transcript variant 2



  "NM_001243286" in other vectors (2)

CNY 3,520.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PVRL3 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD113; CDW113; NECTIN-3; PPR3; PRR3; PVRL3; PVRR3
Vector pCMV6-Entry
Sequence Data
>SC331988 representing NM_001243286.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGCGGACCCTGCGGCCGTCCCCGCTGTGTCCTGGAGGCGGCAAAGCACAACTTTCCTCCGCTTCT
CTCCTCGGAGCCGGGCTCCTGCTGCAGCCCCCGACGCCACCTCCGCTGCTGCTGCTGCTCTTCCCGCTG
CTGCTCTTCTCCAGGCTCTGTGGTGCCTTAGCTGGACCAATTATTGTGGAGCCACATGTCACAGCAGTA
TGGGGAAAGAATGTTTCATTAAAGTGTTTAATTGAAGTAAATGAAACCATAACACAGATTTCATGGGAG
AAGATACATGGCAAAAGTTCACAGACTGTTGCAGTTCACCATCCCCAATATGGATTCTCTGTTCAAGGA
GAATATCAGGGAAGAGTCTTGTTTAAAAATTACTCACTTAATGATGCAACAATTACTCTGCATAACATA
GGATTCTCTGATTCTGGAAAATACATCTGCAAAGCTGTTACATTCCCGCTTGGAAATGCCCAGTCCTCT
ACAACTGTAACTGTGTTAGTTGAACCCACTGTGAGCCTGATAAAAGGGCCAGATTCTTTAATTGATGGA
GGAAATGAAACAGTAGCAGCCATTTGCATCGCAGCCACTGGAAAACCCGTTGCACATATTGACTGGGAA
GGTGATCTTGGTGAAATGGAATCCACTACAACTTCTTTTCCAAATGAAACGGCAACGATTATCAGCCAG
TACAAGCTATTTCCAACCAGATTTGCTAGAGGAAGGCGAATTACTTGTGTTGTAAAACATCCAGCCTTG
GAAAAGGACATCCGATACTCTTTCATATTAGACATACAGTATGCTCCTGAAGTTTCGGTAACAGGATAT
GATGGAAATTGGTTTGTAGGAAGAAAAGGTGTTAATCTCAAATGTAATGCTGATGCAAATCCACCACCC
TTCAAATCTGTGTGGAGCAGGTTGGATGGACAATGGCCTGATGGTTTATTGGCTTCAGACAATACTCTT
CATTTTGTCCATCCATTGACTTTCAATTATTCTGGTGTTTATATCTGTAAAGTGACCAATTCCCTTGGT
CAAAGAAGTGACCAAAAAGTCATCTACATTTCAGCCTACAATTCAGTGGCATCCCTCAACTGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243286
Insert Size 1101 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243286.1
RefSeq Size 5239 bp
RefSeq ORF 1101 bp
Locus ID 25945
UniProt ID Q9NQS3
Protein Families Druggable Genome, Transmembrane
Protein Pathways Adherens junction, Cell adhesion molecules (CAMs)
MW 39.7 kDa
Gene Summary This gene encodes a member of the nectin family of proteins, which function as adhesion molecules at adherens junctions. This family member interacts with other nectin-like proteins and with afadin, a filamentous actin-binding protein involved in the regulation of directional motility, cell proliferation and survival. This gene plays a role in ocular development involving the ciliary body. Mutations in this gene are believed to result in congenital ocular defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (2) uses an alternate splice site that results in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (2) has a distinct and shorter C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...