TRAF3 (NM_001199427) Human Untagged Clone

CAT#: SC331313

TRAF3 (untagged) - Homo sapiens TNF receptor-associated factor 3 (TRAF3), transcript variant 4



  "NM_001199427" in other vectors (2)

CNY 4,024.00

CNY 4,660.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-TRAF3 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAP-1; CAP1; CD40bp; CRAF1; IIAE5; LAP1; RNF118
Vector pCMV6-Entry
Sequence Data
>SC331313 representing NM_001199427.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGTCGAGTAAAAAGATGGACTCTCCTGGCGCGCTGCAGACTAACCCGCCGCTAAAGCTGCACACT
GACCGCAGTGCTGGGACGCCAGTTTTTGTCCCTGAACAAGGAGGTTACAAGGAAAAGTTTGTGAAGACC
GTGGAGGACAAGTACAAGTGTGAGAAGTGCCACCTGGTGCTGTGCAGCCCGAAGCAGACCGAGTGTGGG
CACCGCTTCTGCGAGAGCTGCATGGCGGCCCTGCTGAGCTCTTCAAGTCCAAAATGTACAGCGTGTCAA
GAGAGCATCGTTAAAGATAAGGTGTTTAAGGATAATTGCTGCAAGAGAGAAATTCTGGCTCTTCAGATC
TATTGTCGGAATGAAAGCAGAGGTTGTGCAGAGCAGTTAATGCTGGGACATCTGCTGGTGCATTTAAAA
AATGATTGCCATTTTGAAGAACTTCCATGTGTGCGTCCTGACTGCAAAGAAAAGGTCTTGAGGAAAGAC
CTGCGAGACCACGTGGAGAAGGCGTGTAAATACCGGGAAGCCACATGCAGCCACTGCAAGAGTCAGGTT
CCGATGATCGCGCTGCAGGTTTCCTTGTTGCAGAATGAAAGTGTAGAAAAAAACAAGAGCATACAAAGT
TTGCACAATCAGATATGTAGCTTTGAAATTGAAATTGAGAGACAAAAGGAAATGCTTCGAAATAATGAA
TCCAAAATCCTTCATTTACAGCGAGTGATAGACAGCCAAGCAGAGAAACTGAAGGAGCTTGACAAGGAG
ATCCGGCCCTTCCGGCAGAACTGGGAGGAAGCAGACAGCATGAAGAGCAGCGTGGAGTCCCTCCAGAAC
CGCGTGACCGAGCTGGAGAGCGTGGACAAGAGCGCGGGGCAAGTGGCTCGGAACACAGGCCTGCTGGAG
TCCCAGCTGAGCCGGCATGACCAGATGCTGAGTGTGCACGACATCCGCCTAGCCGACATGGACCTGCGC
TTCCAGGTCCTGGAGACCGCCAGCTACAATGGAGTGCTCATCTGGAAGATTCGCGACTACAAGCGGCGG
AAGCAGGAGGCCGTCATGGGGAAGACCCTGTCCCTTTACAGCCAGCCTTTCTACACTGGTTACTTTGGC
TATAAGATGTGTGCCAGGGTCTACCTGAACGGGGACGGGATGGGGAAGGGGACGCACTTGTCGCTGTTT
TTTGTCATCATGCGTGGAGAATATGATGCCCTGCTTCCTTGGCCGTTTAAGCAGAAAGTGACACTCATG
CTGATGGATCAGGGGTCCTCTCGACGTCATTTGGGAGATGCATTCAAGCCCGACCCCAACAGCAGCAGC
TTCAAGAAGCCCACTGGAGAGATGAATATCGCCTCTGGCTGCCCAGTCTTTGTGGCCCAAACTGTTCTA
GAAAATGGGACATATATTAAAGATGATACAATTTTTATTAAAGTCATAGTGGATACTTCGGATCTGCCC
GATCCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001199427
Insert Size 1458 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199427.1
RefSeq Size 7405 bp
RefSeq ORF 1458 bp
Locus ID 7187
UniProt ID Q13114
Protein Families Druggable Genome
Protein Pathways Pathways in cancer, RIG-I-like receptor signaling pathway, Small cell lung cancer, Toll-like receptor signaling pathway
MW 55.3 kDa
Gene Summary The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from, members of the TNF receptor (TNFR) superfamily. This protein participates in the signal transduction of CD40, a TNFR family member important for the activation of the immune response. This protein is found to be a critical component of the lymphotoxin-beta receptor (LTbetaR) signaling complex, which induces NF-kappaB activation and cell death initiated by LTbeta ligation. Epstein-Barr virus encoded latent infection membrane protein-1 (LMP1) can interact with this and several other members of the TRAF family, which may be essential for the oncogenic effects of LMP1. The protein also plays a role in the regulation of antiviral response. Mutations in this are associated with Encephalopathy, acute, infection-induced, herpes-specific 5. [provided by RefSeq, Jul 2020]
Transcript Variant: This variant (4) differs in the 5' UTR and lacks an in-frame coding segment compared to variant 1. The resulting isoform (2) lacks an internal region as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...