SC35 (SRSF2) (NM_001195427) Human Untagged Clone

CAT#: SC331186

SRSF2 (untagged) - Homo sapiens serine/arginine-rich splicing factor 2 (SRSF2), transcript variant 2



  "NM_001195427" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
SRSF2 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PR264; SC-35; SC35; SFRS2; SFRS2A; SRp30b
Vector pCMV6-Entry
Sequence Data
>SC331186 representing NM_001195427.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGCTACGGCCGCCCCCCTCCCGATGTGGAGGGTATGACCTCCCTCAAGGTGGACAACCTGACCTAC
CGCACCTCGCCCGACACGCTGAGGCGCGTCTTCGAGAAGTACGGGCGCGTCGGCGACGTGTACATCCCG
CGGGACCGCTACACCAAGGAGTCCCGCGGCTTCGCCTTCGTTCGCTTTCACGACAAGCGCGACGCTGAG
GACGCTATGGATGCCATGGACGGGGCCGTGCTGGACGGCCGCGAGCTGCGGGTGCAAATGGCGCGCTAC
GGCCGCCCCCCGGACTCACACCACAGCCGCCGGGGACCGCCACCCCGCAGGTACGGGGGCGGTGGCTAC
GGACGCCGGAGCCGCAGCCCTAGGCGGCGTCGCCGCAGCCGATCCCGGAGTCGGAGCCGTTCCAGGTCT
CGCAGCCGATCTCGCTACAGCCGCTCGAAGTCTCGGTCCCGCACTCGTTCTCGATCTCGGTCGACCTCC
AAGTCCAGATCCGCACGAAGGTCCAAGTCCAAGTCCTCGTCGGTCTCCAGATCTCGTTCGCGGTCCAGG
TCCCGGTCTCGGTCCAGGAGTCCTCCCCCAGTGTCCAAGAGGGAATCCAAATCCAGGTCGCGATCGAAG
AGTCCCCCCAAGTCTCCTGAAGAGGAAGGAGCGGTGTCCTCTTAA

Restriction Sites SgfI-MluI     
ACCN NM_001195427
Insert Size 666 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001195427.1
RefSeq Size 2008 bp
RefSeq ORF 666 bp
Locus ID 6427
UniProt ID Q01130
Protein Families Stem cell - Pluripotency, Transcription Factors
Protein Pathways Spliceosome
MW 25.5 kDa
Gene Summary The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two transcript variants encoding the same protein and one non-coding transcript variant have been found for this gene. In addition, a pseudogene of this gene has been found on chromosome 11. [provided by RefSeq, Sep 2010]
Transcript Variant: This variant (2) differs in the 3' UTR compared to variant 1. Variants 1 and 2 both encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...