NKD2 (NM_001271082) Human Untagged Clone

CAT#: SC330922

NKD2 (untagged) - Homo sapiens naked cuticle homolog 2 (Drosophila) (NKD2), transcript variant 2



  "NM_001271082" in other vectors (2)

CNY 2,640.00

CNY 3,040.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


NKD2 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Naked2
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001271082, the custom clone sequence may differ by one or more nucleotides


ATGGGGAAACTGCAGTCGAAGCACGCCGCCGCCGCCCGCAAGCGGAGAGAGAGCCCGGAAGGGGACAGCT
TCGTGGCGTCCGCGTACGCGAGCGGCCGCAAAGGCGCGGAGGAAGCGGAGCGGCGCGCGCGGGACAAGCA
GGAGCTGCCCAATGGGGACCCCAAGGAGGGGCCTTTCCGGGAGGACCAGTGTCCCCTACAGGTGGCACTC
CCCGCTGAGAAAGCTGAGGGCCGCGAGCACCCGGGACAACTCCTCAGCGCAGATGACGGAGAGAGGGCAG
CAAACCGCGAGGGCCCGCGAGGACCGGGCGGGCAGCGCCTCAACATTGACGCACTCCAGTGCGATGTCTC
GGTGGAGGAGGACGACCGCCAGGAGTGGACGTTCACGCTCTATGACTTTGACAACTGCGGGAAGGTCACC
AGGGAGGACATGTCCAGCCTCATGCACACCATCTATGAGGTCGTGGATGCCTCGGTCAACCACTCCTCGG
GCAGCAGCAAGACCCTCCGTGTGAAGCTAACCGTCAGCCCTGAGCCCTCCAGCAAGAGGAAGGAGGGTCC
TCCTGCTGGCCAGGACCGGGAGCCCACCCGTTGCAGGATGGAGGGTGAACTGGCAGAGGAGCCAAGGGTG
GCTGACAGGAGGTTGTCTGCACACGTCAGGAGGCCCAGTACTGACCCCCAGCCCTGCTCGGAGCGGGGGC
CCTACTGCGTGGACGAGAACACGGAGCGCAGAAACCACTACCTGGACCTCGCCGGGATTGAGAACTACAC
GTCCAGATTCGGCCCTGGGTCTCAGCTGTGCGAGAAGAGAAGCTCCGCTCCCAGGACACACAGTGGGGAC
AAGGCTAGAGGAGTCGGCCTTTGCAGGGAGCTGTGGAGCCAGGCAGGTCACCCACAGTGGCCAGGCCCCT
TCCCTTCAGGGCTGGTGGCCGTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001271082
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271082.1, NP_001258011.1
RefSeq Size 2070 bp
RefSeq ORF 936 bp
Locus ID 85409
UniProt ID Q969F2
Protein Families Druggable Genome
Protein Pathways Wnt signaling pathway
Gene Summary This gene encodes a member of a family of proteins that function as negative regulators of Wnt receptor signaling through interaction with Dishevelled family members. The encoded protein participates in the delivery of transforming growth factor alpha-containing vesicles to the cell membrane. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (2) contains an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...