Asialoglycoprotein Receptor 2 (ASGR2) (NM_001201352) Human Untagged Clone
CAT#: SC329616
ASGR2 (untagged) - Homo sapiens asialoglycoprotein receptor 2 (ASGR2), transcript variant 4
CNY 3,840.00
货期*
现货
规格
Product images
经常一起买 (3)
ASGR2 (Asialoglycoprotein Receptor 2) mouse monoclonal antibody, clone OTI2A12 (formerly 2A12)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ASGP-R2; ASGPR2; CLEC4H2; HBXBP; HL-2 |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001201352, the custom clone sequence may differ by one or more nucleotides
ATGGCCAAGGACTTTCAAGATATCCAGCAGCTGAGCTCGGAGGAAAATGACCATCCTTTCCATCAAGGTG AGGGGCCAGGCACTCGCAGGCTGAATCCCAGGAGAGGAAATCCATTTTTGAAAGGGCCACCTCCTGCCCA GCCCCTGGCACAGCGTCTCTGCTCCATGGTCTGCTTCAGTCTGCTTGCCCTGAGCTTCAACATCCTGCTG CTGGTGGTCATCTGTGTGACTGGGTCCCAAAGTGCACAGCTGCAAGCCGAGCTGCGGAGCCTGAAGGAAG CTTTCAGCAACTTCTCCTCGAGCACCCTGACGGAGGTCCAGGCAATCAGCACCCACGGAGGCAGCGTGGG TGACAAGATCACATCCCTAGGAGCCAAGCTGGAGAAACAGCAGCAGGACCTGAAAGCAGATCACGATGCC CTGCTCTTCCATCTGAAGCACTTCCCCGTGGACCTGCGCTTCGTGGCCTGCCAGATGGAGCTCCTCCACA GCAACGGCTCCCAAAGGACCTGCTGCCCCGTCAACTGGGTGGAGCACCAAGGCAGCTGCTACTGGTTCTC TCACTCCGGGAAGGCCTGGGCTGAGGCGGAGAAGTACTGCCAGCTGGAGAACGCACACCTGGTGGTCATC AACTCCTGGGAGGAGCAGAAATTCATTGTACAACACACGAACCCCTTCAATACCTGGATAGGTCTCACGG ACAGTGATGGCTCTTGGAAATGGGTGGATGGCACAGACTATAGGCACAACTACAAGAACTGGGCTGTCAC TCAGCCAGATAATTGGCACGGGCACGAGCTGGGTGGAAGTGAAGACTGTGTTGAAGTCCAGCCGGATGGC CGCTGGAACGATGACTTCTGCCTGCAGGTGTACCGCTGGGTGTGTGAGAAAAGGCGGAATGCCACCGGCG AGGTGGCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001201352 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001201352.1, NP_001188281.1 |
RefSeq Size | 1441 bp |
RefSeq ORF | 921 bp |
Locus ID | 433 |
UniProt ID | P07307 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (4), also known as H2b, differs in the 5' UTR and uses an alternate splice site in the 5' coding region, but maintains the reading frame, compared to variant H2'. The encoded isoform (d) is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它Asialoglycoprotein Receptor 2产品
Customer
Reviews
Loading...