ATP6V0C (NM_001198569) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	ATP6C; ATP6L; ATPL; VATL; Vma3; VPPC
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC329465 representing NM_001198569. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTCCGAGTCCAAGAGCGGCCCCGAGTATGCTTCGTTTTTCGCCGTCATGGGCGCCTCGGCCGCCATG GTCTTCAGCGCCCTGGGCGCTGCCTATGGCACAGCCAAGAGCGGTACCGGCATTGCGGCCATGTCTGTC ATGCGGCCGGAGCAGATCATGAAGTCCATCATCCCAGTGGTCATGGCTGGCATCATCGCCATCTACGGC CTGGTGGTGGCAGTCCTCATCGCCAACTCCCTGAATGACGACATCAGCCTCTACAAGAGCTTCCTCCAG CTGGGCGCCGGCCTGAGCGTGGGCCTGAGCGGCCTGGCAGCCGGCTTTGCCATCGGCATCGTGGGGGAC GCTGGCGTGCGGGGCACCGCCCAGCAGCCCCGACTATTCGTGGGCATGATCCTGATTCTCATCTTCGCC GAGGTGCTCGGCCTCTACGGTCTCATCGTCGCCCTCATCCTCTCCACAAAGTAG
Restriction Sites	SgfI-MluI
ACCN	NM_001198569
Insert Size	468 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001198569.1
RefSeq Size	1021 bp
RefSeq ORF	468 bp
Locus ID	527
UniProt ID	P27449
Protein Families	Transmembrane
Protein Pathways	Epithelial cell signaling in Helicobacter pylori infection, Lysosome, Metabolic pathways, Oxidative phosphorylation, Vibrio cholerae infection
MW	15.7 kDa
Gene Summary	This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. This gene encodes the V0 subunit c. Alternative splicing results in transcript variants. Pseudogenes have been identified on chromosomes 6 and 17. [provided by RefSeq, Nov 2010] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.