ME2 (NM_001168335) Human Untagged Clone

CAT#: SC328784

ME2 (untagged)-Human malic enzyme 2 NAD(+)-dependent mitochondrial (ME2) nuclear gene encoding mitochondrial protein transcript variant 2



  "NM_001168335" in other vectors (4)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
Rabbit Polyclonal Anti-ME2 Antibody
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ODS1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001168335, the custom clone sequence may differ by one or more nucleotides
ATGTTGTCCCGGTTAAGAGTAGTTTCCACCACTTGTACTTTGGCATGTCGACATTTGCAC
ATAAAAGAAAAAGGCAAGCCACTTATGCTGAACCCAAGAACAAACAAGGGAATGGCATTT
ACTTTACAAGAACGACAAATGCTTGGTCTTCAAGGACTTCTACCTCCCAAAATAGAGACA
CAAGATATTCAAGCCTTACGATTTCATAGAAACTTGAAGAAAATGACTAGCCCTTTGGAA
AAATATATCTACATAATGGGAATACAAGAAAGAAATGAGAAATTGTTTTATAGAATACTG
CAAGATGACATTGAGAGTTTAATGCCAATTGTATATACACCGACGGTTGGTCTTGCCTGC
TCCCAGTATGGACACATCTTTAGAAGACCTAAGGGATTATTTATTTCGATCTCAGACAGA
GGTCATGTTAGATCAATTGTGGATAACTGGCCAGAAAATCATGTTAAGGCTGTTGTAGTG
ACTGATGGAGAGAGAATTCTGGGTCTTGGAGATCTGGGTGTCTATGGAATGGGAATTCCA
GTAGGAAAACTTTGTTTGTATACAGCTTGTGCAGGAATACGGCCTGATAGATGCCTGCCA
GTGTGTATTGATGTGGGAACTGATAATATCGCACTCTTAAAAGACCCATTTTACATGGGC
TTGTACCAGAAACGAGATCGCACACAACAGTATGATGACCTGATTGATGAGTTTATGAAA
GCTATTACTGACAGATATGGCCGGAACACACTCATTCAGTTCGAAGACTTTGGAAATCAT
AATGCATTCAGGTTCTTGAGAAAGTACCGAGAAAAATATTGTACTTTCAATGATGATATT
CAAGGGACAGCTGCAGTAGCTCTAGCAGGTCTTCTTGCAGCACAAAAAGTTATTAGTAAA
CCAATCTCCGAACACAAAATCTTATTCCTTGGAGCAGGAGAGGCTGCTCTTGGAATTGCA
AATCTTATAGTTATGTCTATGGTAGAAAATGGCCTGTCAGAACAAGAGGCACAAAAGAAA
ATCTGGATGTTTGACAAGTATGGTTTATTAGTTAAGGGACGGAAAGCAAAAATAGATAGT
TATCAGGAACCATTTACTCACTCAGCCCCAGAGAGCATACCTGATACTTTTGAAGATGCA
GTGAATATACTGAAGCCTTCAACTATAATTGGAGTTGCAGGTGCTGGCCGTCTTTTCACT
CCTGATGTAATCAGAGCCATGGCCTCTATCAATGAAAGGCCTGTAATATTTGCATTAAGT
AATCCTACAGCACAGGCAGAGTGCACGGCTGAAGAAGCATATACACTTACAGAGGGCAGG
TGTTTGTTTGCCAGTGGCAGTCCATTTGGGCCAGTGAAACTTACAGATGGGCGAGTCTTT
ACACCAGGTCAAGGAAACAATGTTTATATTTTTCCAGGTTACAGAATACCTATATGCTAA
Restriction Sites Please inquire     
ACCN NM_001168335
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001168335.1, NP_001161807.1
RefSeq Size 4468 bp
RefSeq ORF 1440 bp
Locus ID 4200
UniProt ID P23368
Protein Pathways Pyruvate metabolism
Gene Summary This gene encodes a mitochondrial NAD-dependent malic enzyme, a homotetrameric protein, that catalyzes the oxidative decarboxylation of malate to pyruvate. It had previously been weakly linked to a syndrome known as Friedreich ataxia that has since been shown to be the result of mutation in a completely different gene. Certain single-nucleotide polymorphism haplotypes of this gene have been shown to increase the risk for idiopathic generalized epilepsy. Alternatively spliced transcript variants encoding different isoforms found for this gene. [provided by RefSeq, Dec 2009]
Transcript Variant: This variant (2) lacks two alternate in-frame exons in the 3' coding region, compared to variant 1. The resulting protein (isoform 2) is shorter, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...