Proteasome subunit alpha type 6 (PSMA6) (NM_002791) Human Untagged Clone
CAT#: SC321048
PSMA6 (untagged)-Human proteasome (prosome, macropain) subunit, alpha type, 6 (PSMA6)
CNY 2,950.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | IOTA; p27K; PROS27 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_002791.1
GCAACTTCCGGGAGGTGCTTGTGTGCCTGGTGCGGGAGCTACGGGGCCCAGGGATTGTGT
TTAAAGTAGTGCTTCTACCAACATGTCCCGTGGTTCCAGCGCCGGTTTTGACCGCCACAT TACCATTTTTTCACCCGAGGGTCGGCTCTACCAAGTAGAATATGCTTTTAAGGCTATTAA CCAGGGTGGCCTTACATCAGTAGCTGTCAGAGGGAAAGACTGTGCAGTAATTGTCACACA GAAGAAAGTACCTGACAAATTATTGGATTCCAGCACAGTGACTCACTTATTCAAGATAAC TGAAAACATTGGTTGTGTGATGACCGGAATGACAGCTGACAGCAGATCCCAGGTACAGAG GGCACGCTATGAGGCAGCTAACTGGAAATACAAGTATGGCTATGAGATTCCTGTGGACAT GCTGTGTAAAAGAATTGCCGATATTTCTCAGGTCTACACACAGAATGCTGAAATGAGGCC TCTTGGTTGTTGTATGATTTTAATTGGTATAGATGAAGAGCAAGGCCCTCAGGTATATAA GTGTGATCCTGCAGGTTACTACTGTGGGTTTAAAGCCACTGCAGCGGGAGTTAAACAAAC TGAGTCAACCAGCTTCCTTGAAAAAAAAGTGAAGAAGAAATTTGATTGGACATTTGAACA GACAGTGGAAACTGCAATTACATGCCTGTCTACTGTTCTATCAATTGATTTCAAACCTTC AGAAATAGAAGTTGGAGTAGTGACAGTTGAAAATCCTAAATTCAGGATTCTTACAGAAGC AGAGATTGATGCTCACCTTGTTGCTCTAGCAGAGAGAGACTAAACATTGTCGTTAGTTTA CCAGATCCGTGATGCCACTTACCTGTGTGTTTGGTAACAACAAACCAACATCATGGAGGT CCCTGGATTGAAAAAGGAGCCTCTCCCACTCCTCCTACCACCGAAGTGGTTAGGACTCTA TATAAATAAAAACAAGGCTTTTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002791 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002791.1, NP_002782.1 |
RefSeq Size | 1035 bp |
RefSeq ORF | 741 bp |
Locus ID | 5687 |
UniProt ID | P60900 |
Domains | proteasome |
Protein Families | Druggable Genome, Protease, Stem cell - Pluripotency |
Protein Pathways | Proteasome |
Gene Summary | The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Multiple transcript variants encoding several different isoforms have been found for this gene. A pseudogene has been identified on the Y chromosome. [provided by RefSeq, Aug 2013] Transcript Variant: This variant (1) encodes the longest isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209976 | PSMA6 (Myc-DDK-tagged)-Human proteasome (prosome, macropain) subunit, alpha type, 6 (PSMA6) |
CNY 2,400.00 |
|
RC209976L1 | Lenti ORF clone of Human proteasome (prosome, macropain) subunit, alpha type, 6 (PSMA6), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC209976L2 | Lenti ORF clone of Human proteasome (prosome, macropain) subunit, alpha type, 6 (PSMA6), mGFP tagged |
CNY 5,890.00 |
|
RC209976L3 | Lenti ORF clone of Human proteasome (prosome, macropain) subunit, alpha type, 6 (PSMA6), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC209976L4 | Lenti ORF clone of Human proteasome (prosome, macropain) subunit, alpha type, 6 (PSMA6), mGFP tagged |
CNY 5,890.00 |
|
RG209976 | PSMA6 (tGFP-tagged) - Human proteasome (prosome, macropain) subunit, alpha type, 6 (PSMA6) |
CNY 4,000.00 |
|
SC101179 | PSMA6 (untagged)-Human proteasome (prosome, macropain) subunit, alpha type, 6 (PSMA6) |
CNY 2,400.00 |
其它Proteasome subunit alpha type 6产品