United States
Germany
Japan
United Kingdom
China
RNase H1 (RNASEH1) (NM_002936) Human Untagged Clone
CAT＃: SC319446
RNASEH1 (untagged)-Human ribonuclease H1 (RNASEH1)
CNY 2,400.00
CNY 2,950.00
| Cited in 5 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | H1RNA; PEOB2; RNH1 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_002936.3
GTTGAGCGCCGGCGGCTCGCGCCCACGCTGGGCCGGGAGTCGAAATGCTTCCCGGTGCCG
GGAGTGAGCGATGAGCTGGCTTCTGTTCCTGGCCCACAGAGTCGCCTTGGCCGCCTTGCC CTGCCGCCGCGGCTCTCGCGGGTTCGGGATGTTCTATGCCGTGAGGAGGGGCCGCAAGAC CGGGGTCTTTCTGACCTGGAATGAGTGCAGAGCACAGGTGGACCGGTTTCCTGCTGCCAG ATTTAAGAAGTTTGCCACAGAGGATGAGGCCTGGGCCTTTGTCAGGAAATCTGCAAGCCC GGAAGTTTCAGAAGGGCATGAAAATCAACATGGACAAGAATCGGAGGCGAAAGCCAGCAA GCGACTCCGTGAGCCACTGGATGGAGATGGACATGAAAGCGCAGAGCCGTATGCAAAGCA CATGAAGCCGAGCGTGGAGCCGGCGCCTCCAGTTAGCAGAGACACGTTTTCCTACATGGG AGACTTCGTCGTCGTCTACACTGATGGCTGCTGCTCCAGTAATGGGCGTAGAAGGCCGCG AGCAGGAATCGGCGTTTACTGGGGGCCAGGCCATCCTTTAAATGTAGGCATTAGACTTCC TGGGCGGCAGACAAACCAAAGAGCGGAAATTCATGCAGCCTGCAAAGCCATTGAACAAGC AAAGACTCAAAACATCAATAAACTGGTTCTGTATACAGACAGTATGTTTACGATAAATGG TATAACTAACTGGGTTCAAGGTTGGAAGAAAAATGGGTGGAAGACAAGTGCAGGGAAAGA GGTGATCAACAAAGAGGACTTTGTGGCACTGGAGAGGCTTACCCAGGGGATGGACATTCA GTGGATGCATGTTCCTGGTCATTCGGGATTTATAGGCAATGAAGAAGCTGACAGATTAGC CAGAGAAGGAGCTAAACAATCGGAAGACTGAGCCATGTGACTTTAGTCCTTGGGAGAACT TGAGCCAGCGGCTGTCTTGCTGCCTGTACTTACTGGTGTGGAAAATAGCCTGCAGGTAGG ACCATTGCAGTGATGGGCAGATGCGTCTTTCACACGGAATCAGGCACAGTGGCCTTCTGT GACATGTGTTTATAAAAAATGGTTAAGTATATAATAAATTGAACATCTTTGAGATTGGAG AAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_002936 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_002936.3, NP_002927.2 |
| RefSeq Size | 1648 bp |
| RefSeq ORF | 861 bp |
| Locus ID | 246243 |
| UniProt ID | O60930 |
| Domains | rnaseH |
| Protein Pathways | DNA replication |
| Gene Summary | This gene encodes an endonuclease that specifically degrades the RNA of RNA-DNA hybrids and plays a key role in DNA replication and repair. Alternate in-frame start codon initiation results in the production of alternate isoforms that are directed to the mitochondria or to the nucleus. The production of the mitochondrial isoform is modulated by an upstream open reading frame (uORF). Mutations in this gene have been found in individuals with progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 2. Alternative splicing results in additional coding and non-coding transcript variants. Pseudogenes of this gene have been defined on chromosomes 2 and 17. [provided by RefSeq, Jul 2017] Transcript Variant: This variant (1) encodes two isoforms due to the use of alternative translation initiation codons. The longer isoform (1) is derived from the upstream AUG start codon, while the shorter isoform (2) is derived from the downstream AUG start codon. This RefSeq represents the longer isoform (1), which is a mitochondrial protein (see details in PMID: 20823270). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (5)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Locus-specific transcription silencing at the FHIT gene suppresses replication stress-induced copy number variant formation and associated replication delay
,null,
Nucleic Acids Research
,PubMed ID 34181717
[RNASEH1]
|
|
The core spliceosome as target and effector of non-canonical ATM signalling
,Tresini, M;Warmerdam, DO;Kolovos, P;Snijder, L;Vrouwe, MG;Demmers, JA;van IJcken, WF;Grosveld, FG;Medema, RH;Hoeijmakers, JH;Mullenders, LH;Vermeulen, W;Marteijn, JA;,
Nature
,PubMed ID 26106861
[RNASEH1]
|
|
RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells
,Arora, R;Lee, Y;Wischnewski, H;Brun, CM;Schwarz, T;Azzalin, CM;,
Nat Commun
,PubMed ID 25330849
[RNASEH1]
|
|
Increased replication initiation and conflicts with transcription underlie Cyclin E-induced replication stress
,R M Jones, O Mortusewicz, I Afzal, M Lorvellec, P García, T Helleday & E Petermann,
Oncogene doi:10.1038/onc.2012.387
[RNASEH1]
|
|
Topoisomerase I suppresses genomic instability by preventing interference between replication and transcription
,Sandie Tuduri, Laure Crabbé, Chiara Conti, Hélène Tourrière, Heidi Holtgreve-Grez, Anna Jauch, Véronique Pantesco, John De Vos, Aubin Thomas, Charles Theillet, Yves Pommier, Jamal Tazi, Arnaud Coquelle & Philippe Pasero,
Nature Cell Biology 11, 1315 - 1324 (2009)
[RNASEH1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC200595 | RNASEH1 (Myc-DDK-tagged)-Human ribonuclease H1 (RNASEH1) |
CNY 2,400.00 |
|
| RC200595L1 | Lenti ORF clone of Human ribonuclease H1 (RNASEH1), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC200595L2 | Lenti ORF clone of Human ribonuclease H1 (RNASEH1), mGFP tagged |
CNY 4,800.00 |
|
| RC200595L3 | Lenti ORF clone of Human ribonuclease H1 (RNASEH1), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC200595L4 | Lenti ORF clone of Human ribonuclease H1 (RNASEH1), mGFP tagged |
CNY 4,800.00 |
|
| RG200595 | RNASEH1 (tGFP-tagged) - Human ribonuclease H1 (RNASEH1) |
CNY 4,000.00 |
其它RNase H1产品
