Siglec 7 (SIGLEC7) (NM_016543) Human Untagged Clone

CAT#: SC317599

SIGLEC7 (untagged)-Human sialic acid binding Ig-like lectin 7 (SIGLEC7), transcript variant 2



  "NM_016543" in other vectors (5)

CNY 6,080.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
SIGLEC7 mouse monoclonal antibody, clone OTI1A1 (formerly 1A1)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AIRM-1; AIRM1; CD328; CDw328; D-siglec; p75; p75/AIRM1; QA79; SIGLEC-7; SIGLEC19P; SIGLECP2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317599 representing NM_016543.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGCTGCTGCTGCTGCTGCCCCTGCTCTGGGGGAGGGAGAGGGTGGAAGGACAGAAGAGTAACCGG
AAGGATTACTCGCTGACGATGCAGAGTTCCGTGACCGTGCAAGAGGGCATGTGTGTCCATGTGCGCTGC
TCCTTCTCCTACCCAGTGGACAGCCAGACTGACTCTGACCCAGTTCATGGCTACTGGTTCCGGGCAGGG
AATGATATAAGCTGGAAGGCTCCAGTGGCCACAAACAACCCAGCTTGGGCAGTGCAGGAGGAAACTCGG
GACCGATTCCACCTCCTTGGGGACCCACAGACCAAAAATTGCACCCTGAGCATCAGAGATGCCAGAATG
AGTGATGCGGGGAGATACTTCTTTCGTATGGAGAAAGGAAATATAAAATGGAATTATAAATATGACCAG
CTCTCTGTGAACGTGACAGACCCTCCTCAGAACTTGACTGTGACTGTCTTCCAAGGAGAAGGCACAGCA
TCCACAGCTCTGGGGAACAGCTCATCTCTTTCAGTCCTAGAGGGCCAGTCTCTGCGCTTGGTCTGTGCT
GTTGACAGCAATCCCCCTGCCAGGCTGAGCTGGACCTGGAGGAGTCTGACCCTGTACCCCTCACAGCCC
TCAAACCCTCTGGTACTGGAGCTGCAAGTGCACCTGGGGGATGAAGGGGAATTCACCTGTCGAGCTCAG
AACTCTCTGGGTTCCCAGCACGTTTCCCTGAACCTCTCCCTGCAACAGGAGTACACAGGCAAAATGAGG
CCTGTATCAGGAGTGTTGCTGGGGGCGGTCGGGGGAGCTGGAGCCACAGCCCTGGTCTTCCTCTCCTTC
TGTGTCATCTTCATTGTAGTGAGGTCCTGCAGGAAGAAATCGGCAAGGCCAGCAGCGGACGTGGGAGAC
ATAGGCATGAAGGATGCAAACACCATCAGGGGCTCAGCCTCTCAGGGTAACCTGACTGAGTCCTGGGCA
GATGATAACCCCCGACACCATGGCCTGGCTGCCCACTCCTCAGGGGAGGAAAGAGAGATCCAGTATGCA
CCCCTCAGCTTTCATAAGGGGGAGCCTCAGGACCTATCAGGACAAGAAGCCACCAACAATGAGTACTCA
GAGATCAAGATCCCCAAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_016543
Insert Size 1125 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_016543.3
RefSeq Size 1490 bp
RefSeq ORF 1125 bp
Locus ID 27036
UniProt ID Q9Y286
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
MW 41.2 kDa
Gene Summary Putative adhesion molecule that mediates sialic-acid dependent binding to cells. Preferentially binds to alpha-2,3- and alpha-2,6-linked sialic acid. Also binds disialogangliosides (disialogalactosyl globoside, disialyl lactotetraosylceramide and disialyl GalNAc lactotetraoslylceramide). The sialic acid recognition site may be masked by cis interactions with sialic acids on the same cell surface. In the immune response, may act as an inhibitory receptor upon ligand induced tyrosine phosphorylation by recruiting cytoplasmic phosphatase(s) via their SH2 domain(s) that block signal transduction through dephosphorylation of signaling molecules. Mediates inhibition of natural killer cells cytotoxicity. May play a role in hemopoiesis. Inhibits differentiation of CD34+ cell precursors towards myelomonocytic cell lineage and proliferation of leukemic myeloid cells (in vitro).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an in-frame coding exon, compared to variant 1. The resulting isoform (2) lacks an internal segment, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...