COX15 (NM_004376) Human Untagged Clone
CAT#: SC313253
COX15 (untagged)-Human COX15 homolog, cytochrome c oxidase assembly protein (yeast) (COX15), nuclear gene encoding mitochondrial protein, transcript variant 2
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CEMCOX2; MC4DN6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC313253 representing NM_004376.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCAGCGATTGCTCTTTCCGCCGTTGAGGGCCTTGAAGGGGAGGCAGTATCTGCCGCTCCTGGCTCCT AGGGCAGCGCCTAGAGCACAGTGTGATTGCATCAGGCGCCCTTTGAGGCCAGGGCAATACAGCACCATC TCTGAAGTAGCTTTGCAATCTGGAAGGGGTACAGTGTCCCTTCCCTCAAAGGCTGCTGAGCGGGTGGTG GGCCGATGGCTCCTGGTCTGCAGTGGAACAGTGGCTGGAGCAGTTATTCTTGGTGGAGTAACTAGGTTG ACAGAGTCTGGCCTCTCGATGGTAGATTGGCATTTAATAAAGGAGATGAAGCCACCTACAAGCCAAGAG GAATGGGAAGCAGAATTCCAAAGATACCAGCAATTTCCAGAATTTAAAATCTTGAATCATGATATGACA CTGACAGAATTCAAGTTCATCTGGTACATGGAGTACTCACACCGAATGTGGGGTCGCCTTGTAGGCCTT GTGTACATCCTGCCTGCTGCCTACTTTTGGAGAAAGGGCTGGCTCAGCCGTGGCATGAAAGGACGTGTT CTTGCCCTCTGTGGCCTCGTCTGCTTCCAGGGTCTGTTGGGATGGTATATGGTGAAAAGTGGACTAGAA GAAAAATCAGACTCCCATGACATCCCTCGGGTCAGTCAGTACCGCCTTGCTGCCCACCTGGGATCAGCC CTGGTTCTTTATTGTGCCAGCTTGTGGACCTCACTGTCACTGCTACTCCCTCCGCACAAGTTGCCTGAA ACCCACCAACTCCTACAGTTGAGACGATTTGCTCATGGAACAGCAGGTCTGGTGTTCCTTACGGCCCTC TCAGGGGCTTTTGTGGCAGGGCTAGATGCTGGGCTTGTTTATAACTCCTTTCCCAAAATGGGAGAATCC TGGATCCCGGAGGACCTCTTTACCTTCTCCCCCATCCTGAGGAATGTTTTTGAGAATCCCACCATGGTG CAGTTTGATCACCGGATTCTGGGAATCACTTCAGTCACTGCCATTACAGTGCTCTACTTCCTCTCTCGG AGAATTCCCCTTCCTAGAAGGACCAAGATGGCAGCAGTGACTCTGCTGGCTTTGGCGTATACACAGGGC CCTGTCTTATTCAACTTTACTTTTAAAATCAGTGATTTGGATGAAGGCATCAGAAACATCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_004376 |
Insert Size | 1167 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_004376.6 |
RefSeq Size | 4337 bp |
RefSeq ORF | 1167 bp |
Locus ID | 1355 |
UniProt ID | Q7KZN9 |
Domains | COX15-CtaA |
Protein Families | Transmembrane |
Protein Pathways | Metabolic pathways, Oxidative phosphorylation, Porphyrin and chlorophyll metabolism |
MW | 43.8 kDa |
Gene Summary | Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein which is not a structural subunit, but may be essential for the biogenesis of COX formation and may function in the hydroxylation of heme O, according to the yeast mutant studies. This protein is predicted to contain 5 transmembrane domains localized in the mitochondrial inner membrane. Alternative splicing of this gene generates two transcript variants diverging in the 3' region. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an internal segment in the 3' region, as compared to variant 1. The encoded isoform 2 has a shorter and distinct C-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215190 | COX15 (Myc-DDK-tagged)-Human COX15 homolog, cytochrome c oxidase assembly protein (yeast) (COX15), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 3,656.00 |
|
RC215190L3 | Lenti ORF clone of Human COX15 homolog, cytochrome c oxidase assembly protein (yeast) (COX15), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC215190L4 | Lenti ORF clone of Human COX15 homolog, cytochrome c oxidase assembly protein (yeast) (COX15), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG215190 | COX15 (tGFP-tagged) - Human COX15 homolog, cytochrome c oxidase assembly protein (yeast) (COX15), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 4,370.00 |