WNT16 (NM_057168) Human Untagged Clone

CAT#: SC305748

WNT16 (untagged)-Human wingless-type MMTV integration site family, member 16 (WNT16), transcript variant 1



  "NM_057168" in other vectors (6)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal WNT16 Antibody (C-term)
    • 400 ul

CNY 6,314.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC305748 representing NM_057168.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGACAGGGCGGCGCTCCTGGGACTGGCCCGCTTGTGCGCGCTGTGGGCAGCCCTGCTCGTGCTGTTC
CCCTACGGAGCCCAAGGAAACTGGATGTGGTTGGGCATTGCCTCCTTCGGGGTTCCAGAGAAGCTGGGC
TGCGCCAATTTGCCGCTGAACAGCCGCCAGAAGGAGCTGTGCAAGAGGAAACCGTACCTGCTGCCGAGC
ATCCGAGAGGGCGCCCGGCTGGGCATTCAGGAGTGCGGGAGCCAGTTCAGACACGAGAGATGGAACTGC
ATGATCACCGCCGCCGCCACTACCGCCCCGATGGGCGCCAGCCCCCTCTTTGGCTACGAGCTGAGCAGC
GGCACCAAAGAGACAGCATTTATTTATGCTGTGATGGCTGCAGGCCTGGTGCATTCTGTGACCAGGTCA
TGCAGTGCAGGCAACATGACAGAGTGTTCCTGTGACACCACCTTGCAGAACGGCGGCTCAGCAAGTGAA
GGCTGGCACTGGGGGGGCTGCTCCGATGATGTCCAGTATGGCATGTGGTTCAGCAGAAAGTTCCTAGAT
TTCCCCATCGGAAACACCACGGGCAAAGAAAACAAAGTACTATTAGCAATGAACCTACATAACAATGAA
GCTGGAAGGCAGGCTGTCGCCAAGTTGATGTCAGTAGACTGCCGCTGCCACGGAGTTTCCGGCTCCTGT
GCTGTGAAAACATGCTGGAAAACCATGTCTTCTTTTGAAAAGATTGGCCATTTGTTGAAGGATAAATAT
GAAAACAGTATCCAGATATCAGACAAAACAAAGAGGAAAATGCGCAGGAGAGAAAAAGATCAGAGGAAA
ATACCAATCCATAAGGATGATCTGCTCTATGTTAATAAGTCTCCCAACTACTGTGTAGAAGATAAGAAA
CTGGGAATCCCAGGGACACAAGGCAGAGAATGCAACCGTACATCAGAGGGTGCAGATGGCTGCAACCTC
CTCTGCTGTGGCCGAGGTTACAACACCCATGTGGTCAGGCACGTGGAGAGGTGTGAGTGTAAGTTCATC
TGGTGCTGCTATGTCCGTTGCAGGAGGTGTGAAAGCATGACTGATGTCCACACTTGCAAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_057168
Insert Size 1098 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_057168.1
RefSeq Size 3132 bp
RefSeq ORF 1098 bp
Locus ID 51384
UniProt ID Q9UBV4
Protein Families Secreted Protein, Transmembrane
Protein Pathways Basal cell carcinoma, Hedgehog signaling pathway, Melanogenesis, Pathways in cancer, Wnt signaling pathway
MW 40.7 kDa
Gene Summary The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It contains two transcript variants diverging at the 5' termini. These two variants are proposed to be the products of separate promoters and not to be splice variants from a single promoter. They are differentially expressed in normal tissues, one of which (variant 2) is expressed at significant levels only in the pancreas, whereas another one (variant 1) is expressed more ubiquitously with highest levels in adult kidney, placenta, brain, heart, and spleen. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) differs from variant 2 at the 5' terminus including 5' UTR and the coding region for the N-terminus. Isoform 1, encoded by this variant, is 90% identical to the mouse Wnt16 protein at the amino acid level.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...