United States
Germany
Japan
United Kingdom
China
HOXA7 (NM_006896) Human Untagged Clone
CAT＃: SC303846
HOXA7 (untagged)-Human homeobox A7 (HOXA7)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ANTP; HOX1; HOX1.1; HOX1A |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_006896, the custom clone sequence may differ by one or more nucleotides
ATGAGTTCTTCGTATTATGTGAACGCGCTTTTTAGCAAATATACGGCGGGGGCTTCTCTG TTCCAAAATGCCGAGCCGACTTCTTGCTCCTTTGCTCCCAACTCACAGAGAAGCGGCTAC GGGGCGGGCGCCGGCGCCTTCGCCTCGACCGTTCCGGGCTTATACAATGTCAACAGCCCC CTTTATCAGAGCCCCTTTGCGTCCGGCTACGGCCTGGGCGCCGACGCCTACGGCAACCTG CCCTGCGCCTCCTACGACCAAAACATCCCCGGGCTCTGCAGTGACCTCGCCAAAGGCGCC TGCGACAAGACGGACGAGGGCGCGCTGCATGGCGCGGCTGAGGCCAATTTCCGCATCTAC CCCTGGATGCGGTCTTCAGGACCTGACAGGAAGCGGGGCCGCCAGACCTACACGCGCTAC CAGACGCTGGAGCTGGAGAAGGAGTTCCACTTCAACCGCTACCTGACGCGGCGCCGCCGC ATTGAAATCGCCCACGCGCTCTGCCTCACCGAGCGCCAGATTAAGATCTGGTTCCAGAAC CGCCGCATGAAGTGGAAGAAAGAGCATAAGGACGAAGGTCCGACTGCCGCCGCAGCTCCC GAGGGCGCCGTGCCCTCTGCCGCCGCCACTGCTGCCGCGGACAAGGCCGACGAGGAGGAC GATGATGAAGAAGAGGAAGACGAGGAGGAATGA |
| Restriction Sites | Please inquire |
| ACCN | NM_006896 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_006896.3, NP_008827.2 |
| RefSeq Size | 2018 bp |
| RefSeq ORF | 693 bp |
| Locus ID | 3204 |
| UniProt ID | P31268 |
| Protein Families | Transcription Factors |
| Gene Summary | In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. For example, the encoded protein represses the transcription of differentiation-specific genes during keratinocyte proliferation, but this repression is then overcome by differentiation signals. This gene is highly similar to the antennapedia (Antp) gene of Drosophila. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC220703 | HOXA7 (Myc-DDK-tagged)-Human homeobox A7 (HOXA7) |
CNY 3,600.00 |
|
| RC220703L3 | Lenti-ORF clone of HOXA7 (Myc-DDK-tagged)-Human homeobox A7 (HOXA7) |
CNY 5,890.00 |
|
| RC220703L4 | Lenti-ORF clone of HOXA7 (mGFP-tagged)-Human homeobox A7 (HOXA7) |
CNY 5,890.00 |
|
| RG220703 | HOXA7 (tGFP-tagged) - Human homeobox A7 (HOXA7) |
CNY 5,200.00 |
