United States
Germany
Japan
United Kingdom
China
CTNNBIP1 (NM_001012329) Human Untagged Clone
CAT＃: SC301631
CTNNBIP1 (untagged)-Human catenin, beta interacting protein 1 (CTNNBIP1), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ICAT |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC301631 representing NM_001012329.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAACCGCGAGGGAGCTCCCGGGAAGAGTCCGGAGGAGATGTACATTCAGCAGAAGGTCCGAGTGCTG CTCATGCTGCGGAAGATGGGATCAAACCTGACAGCCAGCGAGGAGGAGTTCCTGCGCACCTATGCAGGG GTGGTCAACAGCCAGCTCAGCCAGCTGCCTCCGCACTCCATCGACCAGGGTGCAGAGGACGTGGTGATG GCGTTTTCCAGGTCGGAGACGGAAGACCGGAGGCAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001012329 |
| Insert Size | 246 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001012329.1 |
| RefSeq Size | 2961 bp |
| RefSeq ORF | 246 bp |
| Locus ID | 56998 |
| UniProt ID | Q9NSA3 |
| Protein Families | Druggable Genome, Transcription Factors |
| Protein Pathways | Wnt signaling pathway |
| MW | 9.2 kDa |
| Gene Summary | The protein encoded by this gene binds CTNNB1 and prevents interaction between CTNNB1 and TCF family members. The encoded protein is a negative regulator of the Wnt signaling pathway. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212922 | CTNNBIP1 (Myc-DDK-tagged)-Human catenin, beta interacting protein 1 (CTNNBIP1), transcript variant 2 |
CNY 1,200.00 |
|
| RC212922L3 | Lenti ORF clone of Human catenin, beta interacting protein 1 (CTNNBIP1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC212922L4 | Lenti ORF clone of Human catenin, beta interacting protein 1 (CTNNBIP1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG212922 | CTNNBIP1 (tGFP-tagged) - Human catenin, beta interacting protein 1 (CTNNBIP1), transcript variant 2 |
CNY 4,370.00 |
其它CTNNBIP1产品
