United States
Germany
Japan
United Kingdom
China
MVB12B (NM_001011703) Human Untagged Clone
CAT＃: SC301599
MVB12B (untagged)-Human family with sequence similarity 125, member B (FAM125B), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C9orf28; FAM125B |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC301599 representing NM_001011703.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGAAGCTGCTTCTGCGTGAGACGGAGCCGGGACCCGCCGCCGCCGCAGCCACCGCCGCCGCCGCCC CAGCGGGGAACAGACCAGTCCACCATGCCTGAAGTCAAAGACCTCTCAGAAGCCTTGCCAGAAACGTCA ATGGATCCCATCACGGGAGTCGGGGTGGTGGCTTCTCGGAACCGAGCCCCGACAGGCTATGACGTAGTT GCACAGACAGCAGATGGTGTGGATGCTGACCTCTGGAAAGACGGCTTATTTAAATCCAAGGTTACCAGA TACCTGTGTTTCACAAGATCATTTTCCAAAGAAAATAGTCATCTGGGGAACGTGTTAGTAGATATGAAG CTCATTGACATCAAGGACACACTGCCTGTGGGCTTCATCCCAATTCAGGAGACGGTGGACACACAGGAA GTGGCTTTTAGGAAGAAGAGGCTGTGCATTAAATTTATTCCACGGGATTCAACGGAAGCTGCGATTTGT GACATTCGGATCATGGGCCGGACCAAGCAGGCCCCGCCTCAGTACACGTTTATTGGGGAACTGAACAGC ATGGGGATCTGGTATCGAATGGGCAGAGTACCAAGAAATCATGACTCATCTCAACCCACAACGCCTTCC CAGTCATCAGCTGCCTCCACCCCAGCCCCCAACCTTCCCAGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001011703 |
| Insert Size | 666 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001011703.2 |
| RefSeq Size | 2705 bp |
| RefSeq ORF | 666 bp |
| Locus ID | 89853 |
| UniProt ID | Q9H7P6 |
| Protein Pathways | Endocytosis |
| MW | 24.5 kDa |
| Gene Summary | The protein encoded by this gene is a component of the ESCRT-I complex, a heterotetramer, which mediates the sorting of ubiquitinated cargo protein from the plasma membrane to the endosomal vesicle. ESCRT-I complex plays an essential role in HIV budding and endosomal protein sorting. Depletion and overexpression of this and related protein (MVB12A) inhibit HIV-1 infectivity and induce unusual viral assembly defects, indicating a role for MVB12 subunits in regulating ESCRT-mediated virus budding. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (2) differs at the 3' end compared to variant 1. This results in a shorter isoform (2) with a distinct C-terminus compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC205093 | MVB12B (Myc-DDK-tagged)-Human family with sequence similarity 125, member B (FAM125B), transcript variant 2 |
CNY 2,400.00 |
|
| RC205093L3 | Lenti ORF clone of Human family with sequence similarity 125, member B (FAM125B), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC205093L4 | Lenti ORF clone of Human family with sequence similarity 125, member B (FAM125B), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG205093 | MVB12B (tGFP-tagged) - Human family with sequence similarity 125, member B (FAM125B), transcript variant 2 |
CNY 4,000.00 |
