ATP6V1G2 (NM_138282) Human Untagged Clone

CAT#: SC108966

ATP6V1G2 (untagged)-Human ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2 (ATP6V1G2), transcript variant 2



  "NM_138282" in other vectors (4)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
ATP6V1G2 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ATP6G; ATP6G2; NG38; VMA10
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC108966 sequence for NM_138282 edited (data generated by NextGen Sequencing)
ATGGAGGTGGAGCAATACCGCAGAGAGCGAGAGCACGAATTCCAGAGCAAGCAGCAGGCG
GCCATGGGCTCCCAGGGGAACCTGTCTGCTGAGGTGGAGCAGGCTACAAGGCGCCAGGTG
CAGGGCATGCAGAGCTCCCAGCAGAGAAACCGAGAGCGTGTCCTGGCCCAGCTTCTTGGC
ATGGTCTGCGACGTCAGGCCCCAGGTCCACCCCAACTACCGGATTTCTGCCTAG

Clone variation with respect to NM_138282.2
>OriGene 5' read for NM_138282 unedited
GTAATACGACTCACTTATAGGGCGGCCGCGAATTCGCACGAGGGGCAGCTGAGAAGGTGG
CAGATGCCAGAAAGAGGAAGGCCCGGCGACTGAAGCAGGCAAAGGAGGAGGCACAGATGG
AGGTGGAGCAATACCGCAGAGAGCGAGAGCACGAATTCCAGAGCAAGCAGCAGGCGGCCA
TGGGCTCCCAGGGGAACCTGTCTGCTGAGGTGGAGCAGGCTACAAGGCGCCAGGTGCAGG
GCATGCAGAGCTCCCAGCAGAGAAACCGAGAGCGTGTCCTGGCCCAGCTTCTTGGCATGG
TCTGCGACGTCAGGCCCCAGGTCCACCCCAACTACCGGATTTCTGCCTAGGGCCACCGTA
GGGCCTGACTCCTTCTGCCAGTTCCCTCCCTCAAAGAAATCCTCCAATCAAAATCACCTC
CCACCATAATCCCTGTCTTCTTTCCATCCCCTAGAAATCCTGGGAGGCAGGATCCAATAA
TTTTCCTGTGACACTTATAAATATCCTGCTCACATCTGAATCTCCTTGTTGTTCTTTAAC
CCTCACTGGGACTTTGTAAACTTCCAAGTCATTCTCACCTAAACCCTCTGTGAAATTTGT
AATATGGGGGAAGTAGGGAATGTGGAAAACATCCTGACTTCAGTGTCTGGCCGATGTGGG
TCCCTCTCTTGACCCTGTCACTTGCTGGCTGTGAAACCAGGACAAGCTACTTAACTTGGT
AGCCTCGATGTCCTCCTTTGTGAACTGGGAGATAATATGCCTACCTGNGAGGGGGTGCTC
ATGATTAGAATCATCTGTAAGTCTACACAGTCCTTGCATGTGGTACAGTGATCAGTAGTA
NCACCTGTGATCTATTACACACTGCTCCTGGTCAAACTACCAGNTGTTTCTACGTC
Restriction Sites NotI-NotI     
ACCN NM_138282
Insert Size 4000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_138282.1, NP_612139.1
RefSeq Size 1440 bp
RefSeq ORF 234 bp
Locus ID 534
UniProt ID O95670
Domains V-ATPase_G
Protein Pathways Epithelial cell signaling in Helicobacter pylori infection, Metabolic pathways, Oxidative phosphorylation, Vibrio cholerae infection
Gene Summary This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is one of three V1 domain G subunit proteins. This gene had previous gene symbols of ATP6G and ATP6G2. Alternatively spliced transcript variants encoding different isoforms have been described. Read-through transcription also exists between this gene and the downstream DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B (DDX39B) gene. [provided by RefSeq, Feb 2011]
Transcript Variant: This variant (2) lacks a segment of the 5' UTR and 5' coding region, and uses a downstream start codon, compared to variant 1. The encoded isoform (b), also known as ATP6Galt, is shorter at the N-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...