Meis2 (NM_001136072) Mouse Untagged Clone

CAT#: MC208977

Meis2 (untagged) - Mouse Meis homeobox 2 (Meis2), transcript variant 1, (10ug)



  "NM_001136072" in other vectors (4)

CNY 5,488.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
MEIS2 Antibody - middle region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms A430109D20Rik; Mei; Mrg; Mrg1; Str; Stra10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC208977 representing NM_001136072
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGCAAAGGTACGATGAGCTGCCCCATTACGGCGGGATGGACGGAGTAGGGGTTCCCGCTTCCATGT
ACGGAGACCCTCACGCGCCGCGGCCGATCCCCCCGGTTCACCACCTAAACCACGGGCCGCCGCTCCACGC
CACGCAGCACTACGGCGCGCACGCCCCGCACCCCAATGTCATGCCAGCCAGCATGGGATCTGCTGTCAAC
GACGCCTTGAAAAGAGACAAGGACGCAATCTATGGGCACCCGTTGTTTCCTCTGTTAGCTCTGGTTTTTG
AGAAGTGCGAGCTGGCGACCTGCACTCCCCGGGAACCCGGAGTGGCCGGCGGAGACGTCTGTTCCTCTGA
CTCCTTCAACGAGGACATCGCGGTCTTCGCCAAGCAGGTTCGCGCCGAAAAGCCTCTTTTTTCCTCAAAC
CCAGAGCTGGATAATTTGATGATACAAGCAATTCAAGTACTAAGGTTTCATCTTCTGGAGTTAGAAAAGG
TCCACGAACTATGTGATAACTTCTGCCACCGGTACATTAGCTGTTTGAAGGGAAAAATGCCCATTGACCT
CGTGATTGATGAGAGAGATGGAAGCTCCAAGTCAGATCATGAAGAACTTTCAGGCTCCTCCACAAATCTC
GCCGACCACAACCCTTCATCCTGGCGAGACCACGATGACGCAACCTCAACGCACTCCGCAGGCACCCCAG
GACCCTCCAGTGGGGGCCATGCTTCCCAGAGTGGAGACAACAGCAGTGAGCAAGGCGATGGGTTAGACAA
CAGCGTAGCTTCACCTGGCACAGGTGATGACGACGATCCAGACAAGGACAAAAAACGCCAGAAGAAAAGA
GGCATATTCCCCAAAGTCGCGACAAATATCATGAGAGCGTGGCTCTTCCAGCATCTCACACACCCGTACC
CTTCAGAAGAACAGAAGAAACAGTTAGCGCAAGACACGGGACTGACAATTCTGCAAGTGAACAACTGGTT
TATCAATGCCAGAAGAAGAATAGTGCAGCCCATGATTGACCAGTCAAATCGAGCAGTGAGCCAAGGAGCA
GCGTATAGTCCAGAGGGTCAGCCCATGGGGAGCTTTGTGTTGGATGGTCAGCAACACATGGGGATCCGGC
CTGCAGGACCCATGAGTGGAATGGGCATGAATATGGGCATGGATGGGCAGTGGCACTATATGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_001136072
Insert Size 1185 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001136072.2, NP_001129544.1
RefSeq Size 4716 bp
RefSeq ORF 1185 bp
Locus ID 17536
UniProt ID P97367
Gene Summary This gene encodes a homeobox protein belonging to the TALE ('three amino acid loop extension') family of homeodomain-containing proteins. TALE homeobox proteins are highly conserved transcriptional regulators and several members have been shown to be essential contributors to developmental programs. In mice, a knock-out of this gene leads to lethality at embryonic day 14, accompanied with hemorrhaging. Embryos lacking this gene show defects in tissues derived from the neural crest, suggesting a critical role of this gene during cranial and cardiac neural crest cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Transcript Variant: This variant (1) differs in the 5' and 3' UTRs and has multiple differences in the coding region, compared to variant 9. The encoded isoform (1) is shorter and has distinct N- and C-termini compared to isoform 9. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...