Chmp4b (BC011429) Mouse Untagged Clone
CAT#: MC200873
Chmp4b (untagged) - Mouse chromatin modifying protein 4B (cDNA clone MGC:19416 IMAGE:3485793), (10ug)
CNY 2,000.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2010012F05Rik; C76846; Snf7-2 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC011429
CCCAGCTGCGGGGCGGAGGTGGAGGCGAGGCCTGCGGCTGCGGGGAGCGGCAGGCCGGGAGTGGGCGCGG GAGCCGAGCCGAGCCGAGCCGAGCCGGAGTGGGCGCCGGAGGCCGGCGCGGCGAGCAGCAACCATGTCGG TGTTCGGGAAGCTGTTCGGGGCTGGAGGGGGTAAGGCGGGCAAGGGCGGCCCGACCCCCCAGGAGGCCAT CCAGCGGCTTCGGGACACGGAGGAGATGTTAAGCAAGAAGCAGGAGTTCCTGGAGAAGAAAATCGAACAG GAGCTGACGGCTGCCAAGAAGCACGGCACCAAAAATAAGCGCGCCGCCCTGCAGGCTCTGAAGCGCAAGA AGAGGTATGAGAAGCAGCTGGCACAAATTGATGGCACCCTGTCAACCATCGAGTTCCAGCGGGAGGCCCT AGAGAACGCCAACACCAACACGGAGGTGCTCAAGAACATGGGCTATGCCGCCAAGGCCATGAAGGCTGCC CACGACAACATGGACATTGATAAGGTGGATGAGTTAATGCAGGACATTGCTGACCAGCAAGAACTTGCAG AGGAGATTTCCACAGCTATCTCCAAACCTGTGGGCTTTGGAGAAGAGTTCGACGAGGATGAGCTCATGGC AGAGTTGGAGGAACTTGAACAAGAGGAGTTGGACAAGAATTTGTTGGAGATCAGTGGGCCCGAAACAGTC CCTCTACCAAATGTCCCCTCCGTAGCCCTACCATCCAAACCCGCCAAGAAGAAGGAAGAGGAAGATGACG ACATGAAGGAATTGGAGAACTGGGCCGGATCCATGTAACTGTTCCAGCAGAGGCTGGGCCCAGACGGACT CTGGTGGCCTGTGCATCGGGCAGGCATGTGCGTGCGCAGGGCAGGCAGGACGCGGTGCAGGCAGCCTCCA TCGCTCAGCTCTCACCCAAAGCAGTAGCCGCACCACTGCTCACTCTCGCATAGCATGGTCTGTGCCCAGG GGTGGGTGGGGGGAGGGGGGCGGGGGGGAGGTGCCTGCTGTTTATAATGTTGAATTTCTGTAAAATAAAC TGTATTTGCAAATCCAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | BC011429 |
Insert Size | 675 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC011429, AAH11429 |
RefSeq Size | 1080 bp |
RefSeq ORF | 675 bp |
Locus ID | 75608 |
Gene Summary | Probable core component of the endosomal sorting required for transport complex III (ESCRT-III) which is involved in multivesicular bodies (MVBs) formation and sorting of endosomal cargo proteins into MVBs. MVBs contain intraluminal vesicles (ILVs) that are generated by invagination and scission from the limiting membrane of the endosome and mostly are delivered to lysosomes enabling degradation of membrane proteins, such as stimulated growth factor receptors, lysosomal enzymes and lipids. The MVB pathway appears to require the sequential function of ESCRT-O, -I,-II and -III complexes. ESCRT-III proteins mostly dissociate from the invaginating membrane before the ILV is released. The ESCRT machinery also functions in topologically equivalent membrane fission events, such as the terminal stages of cytokinesis. Together with SPAST, the ESCRT-III complex promotes nuclear envelope sealing and mitotic spindle disassembly during late anaphase. Plays a role in the endosomal sorting pathway. ESCRT-III proteins are believed to mediate the necessary vesicle extrusion and/or membrane fission activities, possibly in conjunction with the AAA ATPase VPS4. When overexpressed, membrane-assembled circular arrays of CHMP4B filaments can promote or stabilize negative curvature and outward budding. CHMP4A/B/C are required for the exosomal release of SDCBP, CD63 and syndecan.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202622 | Chmp4b (tGFP-tagged) - Mouse chromatin modifying protein 4B (cDNA clone MGC:19416 IMAGE:3485793) |
CNY 2,850.00 |
|
MR202622 | Chmp4b (Myc-DDK-tagged) - Mouse chromatin modifying protein 4B (cDNA clone MGC:19416 IMAGE:3485793) |
CNY 2,400.00 |
|
MR202622L3 | Lenti ORF clone of Chmp4b (Myc-DDK-tagged) - Mouse chromatin modifying protein 4B (cDNA clone MGC:19416 IMAGE:3485793) |
CNY 4,750.00 |
|
MR202622L4 | Lenti ORF clone of Chmp4b (mGFP-tagged) - Mouse chromatin modifying protein 4B (cDNA clone MGC:19416 IMAGE:3485793) |
CNY 4,750.00 |