Ifitm2 (BC002160) Mouse Untagged Clone

Specifications

Product Data
Type	Mouse Untagged Clone
Tag	Tag Free
Synonyms	mil-3, fragilis3
Vector	PCMV6-Kan/Neo
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >BC002160 GTTCTAGATCGCGAGCGGCCCCCTTTTTTTTTTTTTTTTTTTTTTTTTTCCATGAGCCACAATTCTCAAG CCTTCTTGTCCACCAATGCCGGGCTTCCTCCAAGCTATGAGACAATCAAAGAGGAGTACGGGGTGACTGA GCTGGGGGAACCCAGCAACTCAGCTGTTGTGAGGACCACCGTGATCAACATGCCCAGAGAGGTGTCGGTG CCTGACCATGTGGTCTGGTCCCTGTTCAATACACTCTTCTTCAACGCCTGCTGCCTGGGCTTCGTTGCCT ATGCCTACTCTGTGAAGTCTAGGGACAGGAAGATGGTGGGCGATGTGGTTGGAGCCCAGGCCTACGCCTC CACTGCCAAGTGCCTGAATATCAGCTCCCTGATCTTCAGCATCCTTATGGTCATTATCTGCATCATTATT TTCTCTACCACCTCTGTGGTAGTCTTTCAGTCTTTTGCACAAAGAACACCCCATTCTGGATTCTAGCTGC CCTGTGCTCCACGGTCCACATCTGCCCCGCCCCTGCCCCGCCCCCAGGCTCAAGCCTCGACCCTTTACCC TACGCGTATGCAAATGTTACCTTCACCTATCTGTCCACAGTGGATTCAATAAAGTGCACGGGGTGGCAAC TCTGAAAAAAAAAAAAAAAAAA
Restriction Sites	RsrII-NotI
ACCN	BC002160
Insert Size	435 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	BC002160, AAH02160
RefSeq Size	652 bp
RefSeq ORF	435 bp
Locus ID	80876
Gene Summary	IFN-induced antiviral protein which inhibits the entry of viruses to the host cell cytoplasm, permitting endocytosis, but preventing subsequent viral fusion and release of viral contents into the cytosol. Active against multiple viruses, including influenza A virus, SARS coronavirus (SARS-CoV), Marburg virus (MARV) and Ebola virus (EBOV), Dengue virus (DNV) and West Nile virus (WNV). Can inhibit: influenza virus hemagglutinin protein-mediated viral entry, MARV and EBOV GP1,2-mediated viral entry and SARS-CoV S protein-mediated viral entry. Induces cell cycle arrest and mediates apoptosis by caspase activation and in p53-independent manner.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.