Retinoic Acid Receptor beta (RARB) (NM_001290266) Human Untagged Clone

CAT#: SC335866

RARB (untagged) - Human retinoic acid receptor, beta (RARB), transcript variant 2



  "NM_001290266" in other vectors (2)

CNY 3,800.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal Retinoic Acid Receptor beta antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HAP; MCOPS12; NR1B2; RARbeta1; RRB2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001290266, the custom clone sequence may differ by one or more nucleotides


CTGGAAAATGCAATTGAAACACAGAGCACCAGCTCTGAGGAACTCGTCCCAAGCCCCCCATCTCCACTTC
CTCCCCCTCGAGTGTACAAACCCTGCTTCGTCTGCCAGGACAAATCATCAGGGTACCACTATGGGGTCAG
CGCCTGTGAGGGATGTAAGGGCTTTTTCCGCAGAAGTATTCAGAAGAATATGATTTACACTTGTCACCGA
GATAAGAACTGTGTTATTAATAAAGTCACCAGGAATCGATGCCAATACTGTCGACTCCAGAAGTGCTTTG
AAGTGGGAATGTCCAAAGAATCTGTCAGGAATGACAGGAACAAGAAAAAGAAGGAGACTTCGAAGCAAGA
ATGCACAGAGAGCTATGAAATGACAGCTGAGTTGGACGATCTCACAGAGAAGATCCGAAAAGCTCACCAG
GAAACTTTCCCTTCACTCTGCCAGCTGGGTAAATACACCACGAATTCCAGTGCTGACCATCGAGTCCGAC
TGGACCTGGGCCTCTGGGACAAATTCAGTGAACTGGCCACCAAGTGCATTATTAAGATCGTGGAGTTTGC
TAAACGTCTGCCTGGTTTCACTGGCTTGACCATCGCAGACCAAATTACCCTGCTGAAGGCCGCCTGCCTG
GACATCCTGATTCTTAGAATTTGCACCAGGTATACCCCAGAACAAGACACCATGACTTTCTCAGACGGCC
TTACCCTAAATCGAACTCAGATGCACAATGCTGGATTTGGTCCTCTGACTGACCTTGTGTTCACCTTTGC
CAACCAGCTCCTGCCTTTGGAAATGGATGACACAGAAACAGGCCTTCTCAGTGCCATCTGCTTAATCTGT
GGAGACCGCCAGGACCTTGAGGAACCGACAAAAGTAGATAAGCTACAAGAACCATTGCTGGAAGCACTAA
AAATTTATATCAGAAAAAGACGACCCAGCAAGCCTCACATGTTTCCAAAGATCTTAATGAAAATCACAGA
TCTCCGTAGCATCAGTGCTAAAGGTGCAGAGCGTGTAATTACCTTGAAAATGGAAATTCCTGGATCAATG
CCACCTCTCATTCAAGAAATGCTGGAGAATTCTGAAGGACATGAACCCTTGACCCCAAGTTCAAGTGGGA
ACACAGCAGAGCACAGTCCTAGCATCTCACCCAGCTCAGTGGAAAACAGTGGGGTCAGTCAGTCACCACT
CGTGCAATAA


Restriction Sites SgfI-MluI     
ACCN NM_001290266
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001290266.1, NP_001277195.1
RefSeq Size 2865 bp
RefSeq ORF 1200 bp
Locus ID 5915
UniProt ID P10826
Protein Families Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
Protein Pathways Non-small cell lung cancer, Pathways in cancer, Small cell lung cancer
Gene Summary This gene encodes retinoic acid receptor beta, a member of the thyroid-steroid hormone receptor superfamily of nuclear transcriptional regulators. This receptor localizes to the cytoplasm and to subnuclear compartments. It binds retinoic acid, the biologically active form of vitamin A which mediates cellular signalling in embryonic morphogenesis, cell growth and differentiation. It is thought that this protein limits growth of many cell types by regulating gene expression. The gene was first identified in a hepatocellular carcinoma where it flanks a hepatitis B virus integration site. Alternate promoter usage and differential splicing result in multiple transcript variants. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (2, also known as beta-4) has an alternate splice site in the 5' region, compared to variant 1. This variant can initiate translation from a non-AUG (CUG) site and also from a downstream, in-frame AUG site (PMID: 12118004). The isoform (4, also known as beta-4) represented in this RefSeq is derived from the CUG start codon, and has a shorter and distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...