GNB3 (NM_001297571) Human Untagged Clone

CAT#: SC335459

GNB3 (untagged) - Human guanine nucleotide binding protein (G protein), beta polypeptide 3 (GNB3), transcript variant 2



  "NM_001297571" in other vectors (2)

CNY 3,330.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
GNB3 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CSNB1H
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335459 representing NM_001297571.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGGAGATGGAGCAACTGCGTCAGGAAGCGGAGCAGCTCAAGAAGCAGATTGCAGATGCCAGGAAA
GCCTGTGCTGACGTTACTCTGGCAGAGCTGGTGTCTGGCCTAGAGGTGGTGGGACGAGTCCAGATGCGG
ACGCGGCGGACGTTAAGGGGACACCTGGCCAAGATTTACGCCATGCACTGGGCCACTGATTCTAAGCTG
CTGGTAAGTGCCTCGCAAGATGGGAAGCTGATCGTGTGGGACAGCTACACCACCAACAAGGTGCACGCC
ATCCCACTGCGCTCCTCCTGGGTCATGACCTGTGCCTATGCCCCATCAGGGAACTTTGTGGCATGTGGG
GGGCTGGACAACATGTGTTCCATCTACAACCTCAAATCCCGTGAGGGCAATGTCAAGGTCAGCCGGGAG
CTTTCTGCTCACACAGGTTATCTCTCCTGCTGCCGCTTCCTGGATGACAACAATATTGTGACCAGCTCG
GGGGACACCACTGCCTTGTGGGACATTGAGACTGGGCAGCAGAAGACTGTATTTGTGGGACACACGGGT
GACTGCATGAGCCTGGCTGTGTCTCCTGACTTCAATCTCTTCATTTCGGGGGCCTGTGATGCCAGTGCC
AAGCTCTGGGATGTGCGAGAGGGGACCTGCCGTCAGACTTTCACTGGCCACGAGTCGGACATCAACGCC
ATCTGTTTCTTCCCCAATGGAGAGGCCATCTGCACGGGCTCGGATGACGCTTCCTGCCGCTTGTTTGAC
CTGCGGGCAGACCAGGAGCTGATCTGCTTCTCCCACGAGAGCATCATCTGCGGCATCACGTCCGTGGCC
TTCTCCCTCAGTGGCCGCCTACTATTCGCTGGCTACGACGACTTCAACTGCAATGTCTGGGACTCCATG
AAGTCTGAGCGTGTGGGCATCCTCTCTGGCCACGATAACAGGGTGAGCTGCCTGGGAGTCACAGCTGAC
GGGATGGCTGTGGCCACAGGTTCCTGGGACAGCTTCCTCAAAATCTGGAACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001297571
Insert Size 1020 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001297571.1
RefSeq Size 1757 bp
RefSeq ORF 1020 bp
Locus ID 2784
UniProt ID P16520
Protein Families Druggable Genome
Protein Pathways Chemokine signaling pathway, Taste transduction
MW 37.1 kDa
Gene Summary Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit which belongs to the WD repeat G protein beta family. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. A single-nucleotide polymorphism (C825T) in this gene is associated with essential hypertension and obesity. This polymorphism is also associated with the occurrence of the splice variant GNB3-s, which appears to have increased activity. GNB3-s is an example of alternative splicing caused by a nucleotide change outside of the splice donor and acceptor sites. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (2) uses an alternate in-frame splice site, in the central coding region, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...