Retinoic Acid Receptor beta (RARB) (NM_001290217) Human Untagged Clone

CAT#: SC335425

RARB (untagged) - Human retinoic acid receptor, beta (RARB), transcript variant 4



  "NM_001290217" in other vectors (2)

CNY 3,230.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal Retinoic Acid Receptor beta antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HAP; MCOPS12; NR1B2; RARbeta1; RRB2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335425 representing NM_001290217.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATTTACACTTGTCACCGAGATAAGAACTGTGTTATTAATAAAGTCACCAGGAATCGATGCCAATAC
TGTCGACTCCAGAAGTGCTTTGAAGTGGGAATGTCCAAAGAATCTGTCAGGAATGACAGGAACAAGAAA
AAGAAGGAGACTTCGAAGCAAGAATGCACAGAGAGCTATGAAATGACAGCTGAGTTGGACGATCTCACA
GAGAAGATCCGAAAAGCTCACCAGGAAACTTTCCCTTCACTCTGCCAGCTGGGTAAATACACCACGAAT
TCCAGTGCTGACCATCGAGTCCGACTGGACCTGGGCCTCTGGGACAAATTCAGTGAACTGGCCACCAAG
TGCATTATTAAGATCGTGGAGTTTGCTAAACGTCTGCCTGGTTTCACTGGCTTGACCATCGCAGACCAA
ATTACCCTGCTGAAGGCCGCCTGCCTGGACATCCTGATTCTTAGAATTTGCACCAGGTATACCCCAGAA
CAAGACACCATGACTTTCTCAGACGGCCTTACCCTAAATCGAACTCAGATGCACAATGCTGGATTTGGT
CCTCTGACTGACCTTGTGTTCACCTTTGCCAACCAGCTCCTGCCTTTGGAAATGGATGACACAGAAACA
GGCCTTCTCAGTGCCATCTGCTTAATCTGTGGAGACCGCCAGGACCTTGAGGAACCGACAAAAGTAGAT
AAGCTACAAGAACCATTGCTGGAAGCACTAAAAATTTATATCAGAAAAAGACGACCCAGCAAGCCTCAC
ATGTTTCCAAAGATCTTAATGAAAATCACAGATCTCCGTAGCATCAGTGCTAAAGGTGCAGAGCGTGTA
ATTACCTTGAAAATGGAAATTCCTGGATCAATGCCACCTCTCATTCAAGAAATGCTGGAGAATTCTGAA
GGACATGAACCCTTGACCCCAAGTTCAAGTGGGAACACAGCAGAGCACAGTCCTAGCATCTCACCCAGC
TCAGTGGAAAACAGTGGGGTCAGTCAGTCACCACTCGTGCAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001290217
Insert Size 1011 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001290217.1
RefSeq Size 2680 bp
RefSeq ORF 1011 bp
Locus ID 5915
UniProt ID P10826
Protein Families Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
Protein Pathways Non-small cell lung cancer, Pathways in cancer, Small cell lung cancer
MW 37.9 kDa
Gene Summary This gene encodes retinoic acid receptor beta, a member of the thyroid-steroid hormone receptor superfamily of nuclear transcriptional regulators. This receptor localizes to the cytoplasm and to subnuclear compartments. It binds retinoic acid, the biologically active form of vitamin A which mediates cellular signalling in embryonic morphogenesis, cell growth and differentiation. It is thought that this protein limits growth of many cell types by regulating gene expression. The gene was first identified in a hepatocellular carcinoma where it flanks a hepatitis B virus integration site. Alternate promoter usage and differential splicing result in multiple transcript variants. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (4, also known as beta-5) has an alternate 5' exon, compared to variant 1. The resulting isoform (2, also known as beta', formerly, beta-4) has a shorter N-terminus, compared to isoform 1. Three variants in this gene encode the same isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Retinoic Acid Receptor beta产品

Customer Reviews 
Loading...