SH3GL3 (NM_001301108) Human Untagged Clone

CAT#: SC335012

SH3GL3 (untagged) - Human SH3-domain GRB2-like 3 (SH3GL3), transcript variant EEN-B2-L2



  "NM_001301108" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
SH3GL3 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CNSA3; EEN-B2; HsT19371; SH3D2C; SH3P13
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001301108, the custom clone sequence may differ by one or more nucleotides


ATGCTGAACACTGTGTCGAAGATCCGAGGGCAGGTGAAGACCACAGGATACCCGCAGACGGAAGGCTTGC
TGGGGGACTGTATGCTGAAATACGGGAAGGAGCTCGGGGAAGACTCCACCTTTGGCAATGCATTGATAGA
AGTTGGTGAATCCATGAAGCTAATGGCTGAGGTGAAAGACTCTCTTGATATTAATGTAAAGCAAACTTTT
ATTGATCCACTTCAGTTACTACAAGATAAAGATTTAAAAGAGATCGGGCATCACCTGAAAAAGCTGGAAG
GCCGCCGCCTGGATTACGATTATAAAAAGAAACGAGTAGGTAAGATACCAGACGAAGAAGTCAGACAAGC
GGTAGAAAAATTTGAAGAGTCAAAGGAGTTGGCTGAAAGAAGCATGTTTAACTTTTTAGAAAATGATGTA
GAACAAGTCAGCCAGTTGGCTGTGTTCATAGAGGCAGCATTAGACTATCACAGACAGTCCACAGAGATTC
TGCAGGAGCTGCAGAGCAAGCTACAGATGCGAATATCAGCTGCATCCAGTGTCCCCAGACGAGAATACAA
GCCAAGGCCTGTGAAAAGGAGTTCTAGTGAGCTCAATGGAGTTTCCACCACCTCTGTAGTGAAGACGACA
GGTTCTAACATTCCCATGGACCAGCCCTGCTGTCGTGGTCTCTATGACTTTGAGCCAGAAAACCAAGGAG
AATTAGGATTTAAAGAAGGGGACATCATTACATTAACCAATCAAATAGATGAAAACTGGTATGAAGGAAT
GATACACGGAGAATCGGGATTCTTCCCCATTAATTACGTGGAAGTGATCGTGCCTTTACCTCAGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001301108
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001301108.1, NP_001288037.1
RefSeq Size 1836 bp
RefSeq ORF 837 bp
Locus ID 6457
UniProt ID Q99963
Protein Pathways Endocytosis
Gene Summary Implicated in endocytosis. May recruit other proteins to membranes with high curvature (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (EEN-B2-L2) uses an alternate splice site, and it thus differs in its 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant EEN-B2-L1. The encoded isoform (b) is shorter at the N-terminus, compared to isoform a. Variants 2, 9, and 14 all encode the same isoform (b).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...