CD48 (NM_001256030) Human Untagged Clone

CAT#: SC334841

CD48 (untagged) - Human CD48 molecule (CD48), transcript variant 2



  "NM_001256030" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CD48 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BCM1; BLAST; BLAST1; hCD48; mCD48; MEM-102; SLAMF2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001256030, the custom clone sequence may differ by one or more nucleotides


ATGTGCTCCAGAGGTTGGGATTCGTGTCTGGCTCTGGAATTGCTACTGCTGCCTCTGTCACTCCTGGTGA
CCAGCATTCAAGGTCACTTGGTACATATGACCGTGGTCTCCGGCAGCAACGTGACTCTGAACATCTCTGA
GAGCCTGCCTGAGAACTACAAACAACTAACCTGGTTTTATACTTTCGACCAGAAGATTGTAGAATGGGAT
TCCAGAAAATCTAAGTACTTTGAATCCAAATTTAAAGGCAGGGTCAGACTTGATCCTCAGAGTGGCGCAC
TGTACATCTCTAAGGTCCAGAAAGAGGACAACAGCACCTACATCATGAGGGTGTTGAAAAAGACTGGGAA
TGAGCAAGAATGGAAGATCAAGCTGCAAGTGCTTGACCCTGTACCCAAGCCTGTCATCAAAATTGAGAAG
ATAGAAGACATGGATGACAACTGTTATCTGAAACTGTCATGTGTGATACCTGGCGAGTCTGTAAACTACA
CCTGGTATGGGGACAAAAGGCCCTTCCCAAAGGAGCTCCAGAACAGTGTGCTTGAAACCACCCTTATGCC
ACATAATTACTCCAGGTGTTATACTTGCCAAGTCAGCAATTCTGTGAGCAGCAAGAATGGCACGGTCTGC
CTCAGTCCACCCTGTACCCTGGGTAAGAAGGATCCCTGGGAGCTGAGGGGGGCACAGGGTAACTGGAGTT
GTTTTGAACAAAGAAAGGCTGGGGGTCCTATTCAGCCTCCTTGCACAGTGTGGTGGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001256030
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256030.1, NP_001242959.1
RefSeq Size 1537 bp
RefSeq ORF 759 bp
Locus ID 962
Protein Families Druggable Genome, Transmembrane
Protein Pathways Natural killer cell mediated cytotoxicity
Gene Summary This gene encodes a member of the CD2 subfamily of immunoglobulin-like receptors which includes SLAM (signaling lymphocyte activation molecules) proteins. The encoded protein is found on the surface of lymphocytes and other immune cells, dendritic cells and endothelial cells, and participates in activation and differentiation pathways in these cells. The encoded protein does not have a transmembrane domain, however, but is held at the cell surface by a GPI anchor via a C-terminal domain which maybe cleaved to yield a soluble form of the receptor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (2) differs in the 3' UTR and coding region compared to variant 1. The resulting protein (isoform 2) is longer and has a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...