TNNT3 (NM_001297646) Human Untagged Clone

CAT#: SC334820

TNNT3 (untagged) - Human troponin T type 3 (skeletal, fast) (TNNT3), transcript variant 5



  "NM_001297646" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-TNNT3
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms beta-TnTF; DA2B2; TNTF
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001297646, the custom clone sequence may differ by one or more nucleotides


ATGTCTGACGAGGAAGTTGAACAGGTGGAGGAGCAGTACGAAGAAGAAGAGGAAGCCCAGGAGGAAGAGG
AAGTTCAAGAAGAGGAGAAACCGAGACCCAAACTCACTGCTCCTAAGATCCCAGAAGGGGAGAAAGTGGA
CTTCGATGACATCCAGAAGAAGCGTCAGAACAAAGACCTAATGGAGCTCCAGGCCCTCATCGACAGCCAC
TTTGAAGCCCGGAAGAAGGAGGAGGAGGAGCTGGTCGCTCTCAAAGAGAGAATCGAGAAGCGCCGTGCAG
AGAGAGCGGAGCAGCAGAGGATTCGTGCAGAGAAGGAGAGGGAGCGCCAGAACAGACTGGCGGAGGAAAA
GGCCAGAAGGGAGGAGGAGGATGCCAAGAGGAGGGCAGAGGACGACCTGAAGAAGAAGAAAGCTCTGTCT
TCCATGGGAGCCAACTACAGCAGCTACCTGGCCAAGGCTGACCAGAAGAGAGGCAAGAAGCAGACAGCCC
GGGAAATGAAGAAGAAGATTCTGGCTGAGAGACGCAAGCCGCTCAACATCGATCACCTTGGTGAAGACAA
ACTGAGGGACAAGGCCAAGGAGCTCTGGGAGACCCTGCACCAGCTGGAGATTGACAAGTTCGAGTTTGGG
GAGAAGCTGAAACGCCAGAAATATGACATCACCACGCTCAGGAGCCGCATTGACCAGGCCCAGAAGCACA
GCAAGAAGGCTGGGACCCCAGCCAAGGGCAAAGTCGGCGGGCGCTGGAAGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001297646
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001297646.1, NP_001284575.1
RefSeq Size 1451 bp
RefSeq ORF 753 bp
Locus ID 7140
UniProt ID P45378
Gene Summary The binding of Ca(2+) to the trimeric troponin complex initiates the process of muscle contraction. Increased Ca(2+) concentrations produce a conformational change in the troponin complex that is transmitted to tropomyosin dimers situated along actin filaments. The altered conformation permits increased interaction between a myosin head and an actin filament which, ultimately, produces a muscle contraction. The troponin complex has protein subunits C, I, and T. Subunit C binds Ca(2+) and subunit I binds to actin and inhibits actin-myosin interaction. Subunit T binds the troponin complex to the tropomyosin complex and is also required for Ca(2+)-mediated activation of actomyosin ATPase activity. There are 3 different troponin T genes that encode tissue-specific isoforms of subunit T for fast skeletal-, slow skeletal-, and cardiac-muscle. This gene encodes fast skeletal troponin T protein; also known as troponin T type 3. Alternative splicing results in multiple transcript variants encoding additional distinct troponin T type 3 isoforms. A developmentally regulated switch between fetal/neonatal and adult troponin T type 3 isoforms occurs. Additional splice variants have been described but their biological validity has not been established. Mutations in this gene may cause distal arthrogryposis multiplex congenita type 2B (DA2B). [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (5) differs in the 5' UTR and lacks an internal coding exon compared to transcript variant 1, resulting in a shorter isoform (4) missing an 8 aa segment compared to isoform 1. Variants 4, 5, and 9 all encode the same isoform (4).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...