KCTD17 (NM_001282685) Human Untagged Clone
CAT#: SC334604
KCTD17 (untagged) - Human potassium channel tetramerization domain containing 17 (KCTD17), transcript variant 3
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282685, the custom clone sequence may differ by one or more nucleotides
ATGCAGACGCCGCGGCCGGCGATGAGGATGGAGGCCGGGGAGGCAGCGCCGCCGGCGGGGGCGGGCGGCC GCGCCGCAGGCGGCTGGGGCAAGTGGGTGCGGCTCAACGTGGGGGGCACGGTGTTCCTGACCACCCGGCA GACGCTGTGCCGCGAGCAGAAGTCCTTCCTCAGCCGCCTGTGCCAGGGGGAAGAGCTGCAGTCGGACCGG GATGAGACCGGGGCCTACCTCATTGACCGTGACCCCACCTACTTCGGGCCCATCCTGAACTTCCTCCGGC ATGGCAAGCTGGTGCTGGACAAGGACATGGCTGAGGAGGGGGTCCTGGAGGAAGCCGAGTTCTACAACAT CGGCCCGCTGATCCGCATCATCAAAGACCGGATGGAAGAGAAGGACTACACGGTCACCCAGGTCCCACCC AAGCACGTGTACCGCGTGCTGCAGTGCCAGGAGGAGGAGCTCACGCAAATGGTCTCCACCATGTCTGATG GCTGGCGCTTCGAGCAGCTGGTGAACATCGGCTCCTCCTACAACTACGGCAGCGAGGACCAGGCAGAGTT CCTGTGTGTGGTGTCCAAGGAGCTCCACAGCACCCCAAACGGGCTGAGCTCAGAGTCCAGCCGCAAAACC AAGGTTCCCGTCCGCACCCTCTCAGACCTGAGGCTGAGCTTGCAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282685 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001282685.1, NP_001269614.1 |
RefSeq Size | 1607 bp |
RefSeq ORF | 678 bp |
Locus ID | 79734 |
UniProt ID | Q8N5Z5 |
Protein Families | Ion Channels: Other |
Gene Summary | This gene encodes a protein that belongs to a conserved family of potassium channel tetramerization domain (KCTD)-containing proteins. The encoded protein functions in ciliogenesis by acting as a substrate adaptor for the cullin3-based ubiquitin-conjugating enzyme E3 ligase, and targets trichoplein, a keratin-binding protein, for degradation via polyubiquitinylation. A mutation in this gene is associated with autosomal dominant myoclonic dystonia 26. [provided by RefSeq, Nov 2016] Transcript Variant: This variant (3) lacks two alternate exons in the 3' coding region, which results in a frameshift and an early stop codon, compared to variant 1. It encodes isoform 3, which has a shorter and distinct C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236710 | KCTD17 (myc-DDK-tagged) - Human potassium channel tetramerization domain containing 17 (KCTD17), transcript variant 3 |
CNY 3,990.00 |
|
RG236710 | KCTD17 (tGFP-tagged) - Human potassium channel tetramerization domain containing 17 (KCTD17), transcript variant 3 |
CNY 4,370.00 |