Major Basic Protein (PRG2) (NM_001302927) Human Untagged Clone
CAT#: SC334583
PRG2 (untagged) - Human proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein) (PRG2), transcript variant 4
CNY 2,950.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BMPG; MBP; MBP1; proMBP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001302927, the custom clone sequence may differ by one or more nucleotides
ATGAAACTCCCCTTACTTCTGGCTCTTCTATTTGGGGCAGTTTCTGCTCTTCATCTAAGGTCTGAGACTT CCACCTTTGAGACCCCTTTGGGTGCTAAGACGCTGCCTGAGGATGAGGAGACACCAGAGCAGGAGATGGA GGAGACCCCTTGCAGGGAGCTGGAGGAAGAGGAGGAGTGGGGCTCTGGAAGTGAAGATGCCTCCAAGAAA GATGGGGCTGTTGAGTCTATCTCAGTGCCAGATATGGTGGACAAAAACCTTACGTGTCCTGAGGAAGAGG ACACAGTAAAAGTGGTGGGCATCCCTGGGTGCCAGACCTGCCGCTACCTCCTGGTGAGAAGTCTTCAGAC GTTTAGTCAAGCTTGGTTTACTTGCCGGAGGTGCTACAGGGGCAACCTGGTTTCCATCCACAACTTCAAT ATTAATTATCGAATCCAGTGTTCTGTCAGCGCGCTCAACCAGGGTCAAGTCTGGATTGGAGGCAGGATCA CAGGCTCGGGTCGCTGCAGACGCTTTCAGTGGGTTGACGGCAGCCGCTGGAACTTTGCGTACTGGGCTGC TCACCAGCCCTGGTCCCGCGGTGGTCACTGCGTGGCCCTGTGTACCCGAGGAGGCCACTGGCGTCGAGCC CACTGCCTCAGAAGACTTCCTTTCATCTGTTCCTACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001302927 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001302927.1, NP_001289856.1 |
RefSeq Size | 1544 bp |
RefSeq ORF | 669 bp |
Locus ID | 5553 |
UniProt ID | P13727 |
Protein Families | Secreted Protein |
Protein Pathways | Asthma |
Gene Summary | The protein encoded by this gene is the predominant constituent of the crystalline core of the eosinophil granule. High levels of the proform of this protein are also present in placenta and pregnancy serum, where it exists as a complex with several other proteins including pregnancy-associated plasma protein A (PAPPA), angiotensinogen (AGT), and C3dg. This protein may be involved in antiparasitic defense mechanisms as a cytotoxin and helminthotoxin, and in immune hypersensitivity reactions. The encoded protein contains a peptide that displays potent antimicrobial activity against Gram-positive bacteria, Gram-negative bacteria, and fungi. It is directly implicated in epithelial cell damage, exfoliation, and bronchospasm in allergic diseases. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014] Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1, 3, and 4 all encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236689 | PRG2 (myc-DDK-tagged) - Human proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein) (PRG2), transcript variant 4 |
CNY 2,400.00 |
|
RG236689 | PRG2 (tGFP-tagged) - Human proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein) (PRG2), transcript variant 4 |
CNY 4,370.00 |