Casein Kinase 2 beta (CSNK2B) (NM_001282385) Human Untagged Clone

CAT#: SC334499

CSNK2B (untagged) - Human casein kinase 2, beta polypeptide (CSNK2B), transcript variant 2



  "NM_001282385" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-CSNK2B Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CK2B; CK2N; Ckb1; Ckb2; CSK2B; G5A; POBINDS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282385, the custom clone sequence may differ by one or more nucleotides


ATGAGCAGCTCAGAGGAGGTGTCCTGGATTTCCTGGTTCTGTGGGCTCCGTGGCAATGAATTCTTCTGTG
AAGTGGATGAAGACTACATCCAGGACAAATTTAATCTTACTGGACTCAATGAGCAGGTCCCTCACTATCG
ACAAGCTCTAGACATGATCTTGGACCTGGAGCCTGATGAAGAACTGGAAGACAACCCCAACCAGAGTGAC
CTGATTGAGCAGGCAGCCGAGATGCTTTATGGATTGATCCACGCCCGCTACATCCTTACCAACCGTGGCA
TCGCCCAGATGTTGGAAAAGTACCAGCAAGGAGACTTTGGTTACTGTCCTCGTGTGTACTGTGAGAACCA
GCCAATGCTTCCCATTGACATCCCAGGTGAAGCCATGGTGAAGCTCTACTGCCCCAAGTGCATGGATGTG
TACACACCCAAGTCATCAAGACACCATCACACGGATGGCGCCTACTTCGGCACTGGTTTCCCTCACATGC
TCTTCATGGTGCATCCCGAGTACCGGCCCAAGAGACCTGCCAACCAGTTTGTGCCCAGGCTCTACGGTTT
CAAGATCCATCCGATGGCCTACCAGCTGCAGCTCCAAGCCGCCAGCAACTTCAAGAGCCCAGTCAAGACG
ATTCGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001282385
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282385.1, NP_001269314.1
RefSeq Size 1140 bp
RefSeq ORF 639 bp
Locus ID 1460
UniProt ID P67870
Protein Families Druggable Genome
Protein Pathways Adherens junction, Tight junction, Wnt signaling pathway
Gene Summary This gene encodes the beta subunit of casein kinase II, a ubiquitous protein kinase which regulates metabolic pathways, signal transduction, transcription, translation, and replication. The enzyme is composed of three subunits, alpha, alpha prime and beta, which form a tetrameric holoenzyme. The alpha and alpha prime subunits are catalytic, while the beta subunit serves regulatory functions. The enzyme localizes to the endoplasmic reticulum and the Golgi apparatus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (2) uses an alternate in-frame splice junction in the 3' coding sequence compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...