SV2A (NM_001278719) Human Untagged Clone

CAT#: SC334363

SV2A (untagged) - Human synaptic vesicle glycoprotein 2A (SV2A), transcript variant 2



  "NM_001278719" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-SV2A Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SV2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278719, the custom clone sequence may differ by one or more nucleotides


ATGACTGCCTGCTTATCTTGGCCTTTGCCCACAGACCTGTTCGAGTACAAGTTTGTGAACAGCCGTCTGA
TAAACAGTACATTCCTGCACAACAAGGAGGGCTGCCCGCTAGACGTGACAGGGACGGGCGAAGGTGCCTA
CATGGTATACTTTGTGAGCTTCCTGGGGACACTGGCAGTGCTTCCTGGGAATATCGTGTCTGCCCTGCTC
ATGGACAAGATCGGCAGGCTCAGAATGCTTGCTGGCTCCAGCGTGATGTCCTGTGTCTCCTGCTTCTTCC
TGTCTTTTGGGAACAGTGAGTCGGCCATGATCGCTCTGCTCTGCCTTTTTGGCGGGGTCAGCATTGCATC
CTGGAATGCGCTGGACGTGTTGACTGTTGAACTCTACCCCTCAGACAAGAGGACCACAGCTTTTGGCTTC
CTGAATGCCCTGTGTAAGCTGGCAGCTGTGCTGGGGATCAGCATCTTCACATCCTTCGTGGGAATCACCA
AGGCTGCACCCATCCTCTTTGCCTCAGCTGCCCTTGCCCTTGGCAGCTCTCTGGCCCTGAAGCTGCCTGA
GACCCGGGGGCAGGTGCTGCAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001278719
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278719.1, NP_001265648.1
RefSeq Size 2394 bp
RefSeq ORF 585 bp
Locus ID 9900
UniProt ID Q7L0J3
Protein Families Secreted Protein, Transmembrane
Protein Pathways ECM-receptor interaction
Gene Summary The protein encoded by this gene is one of three related synaptic vesicle proteins. The encoded protein may interact with synaptotagmin to enhance low frequency neurotransmission in quiescent neurons. [provided by RefSeq, Jun 2016]
Transcript Variant: This variant (2) contains an alternate segment in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...