Phytoceramidase (ACER3) (NM_001300955) Human Untagged Clone

CAT#: SC334149

ACER3 (untagged) - Human alkaline ceramidase 3 (ACER3), transcript variant 4



  "NM_001300955" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-PHCA antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms APHC; PHCA; PLDECO
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001300955, the custom clone sequence may differ by one or more nucleotides


ATGATATACAGCTGTTGCATATTTGTGTACTGCATGTTTGAATGTTTCAAGATCAAGAACTCAGTAAACT
ACCATCTGCTTTTTACCTTAGTTCTATTCAGTTTAATAGTAACCACAGTTTACCTTAAGGTAAAAGAGCC
GATATTCCATCAGGTCATGTATGGAATGTTGGTCTTTACATTAGTACTTCGATCTATTTATATTGTTACA
TGGGTTTATCCATGGCTTAGAGGACTGGGTTATACATCATTGGGTATATTTTTATTGGGATTTTTATTTT
GGAATATAGATAACATATTTTGTGAGTCACTGAGGAACTTTCGAAAGAAGGTACCACCTATCATAGGTAT
TACCACACAATTTCATGCATGGTGGCATATTTTAACTGGCCTTGGTTCCTATCTTCACATCCTTTTCAGT
TTGTATACAAGAACACTTTACCTGAGATATAGGCCAAAAGTGAAGTTTCTCTTTGGAATCTGGCCAGTGA
TCCTGTTTGAGCCTCTCAGGAAGCATTGA


Restriction Sites SgfI-MluI     
ACCN NM_001300955
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001300955.1, NP_001287884.1
RefSeq Size 7337 bp
RefSeq ORF 519 bp
Locus ID 55331
Protein Families Transmembrane
Protein Pathways Sphingolipid metabolism
Gene Summary Endoplasmic reticulum and Golgi ceramidase that catalyzes the hydrolysis of unsaturated long-chain C18:1-, C20:1- and C20:4-ceramides, dihydroceramides and phytoceramides into sphingoid bases like sphingosine and free fatty acids at alkaline pH (PubMed:20068046, PubMed:26792856, PubMed:20207939, PubMed:11356846, PubMed:30575723). Ceramides, sphingosine, and its phosphorylated form sphingosine-1-phosphate are bioactive lipids that mediate cellular signaling pathways regulating several biological processes including cell proliferation, apoptosis and differentiation (PubMed:20068046). Controls the generation of sphingosine in erythrocytes, and thereby sphingosine-1-phosphate in plasma (PubMed:20207939). Through the regulation of ceramides and sphingosine-1-phosphate homeostasis in the brain may play a role in neurons survival and function (By similarity). By regulating the levels of proinflammatory ceramides in immune cells and tissues, may modulate the inflammatory response (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) lacks an alternate exon and uses a downstream translation start codon compared to variant 1. The resulting isoform (c) is shorter at the N-terminus compared to isoform a. Variants 3 and 4 both encode the same isoform (c). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...