CDIPT (NM_001286585) Human Untagged Clone

CAT#: SC334117

CDIPT (untagged) - Human CDP-diacylglycerol--inositol 3-phosphatidyltransferase (CDIPT), transcript variant 2



  "NM_001286585" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
CDIPT Antibody - C-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PIS; PIS1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334117 representing NM_001286585.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCAGACGAAAATATCTTCCTGTTCGTGCCCAACCTCATCGGAACCCGGTTTGGGGCCATGCTGGAC
ATGCTGACGGACCGCTGCTCCACCATGTGCCTGTTGGTCAACCTGGCCCTGCTGTACCCTGGAGCCACG
CTGTTCTTCCAAATCAGCATGAGTTTGGATGTGGCCAGTCACTGGCTGCACCTCCACAGTTCTGTGGTC
CGAGGCAGTGAGAGTCACAAGATGATCGACTTGTCCGGGAATCCGGTGCTTCGGATCTACTACACCTCG
AGGCCTGCTCTGTTCACCTTGTGTGCTGGGAATGAGCTCTTCTACTGCCTCCTCTACCTGTTCCATTTC
TCTGAGGGACCTTTAGTTGGCTCTGTGGGACTGTTCCGGATGGGCCTCTGGGTCACTGCCCCCATCGCC
TTGCTGAAGTCGCTCATCAGCGTCATCCACCTGATCACGGCCGCCCGCAACATGGCTGCCCTGGACGCA
GCAGACCGCGCCAAGAAGAAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001286585
Insert Size 507 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286585.1
RefSeq Size 1793 bp
RefSeq ORF 507 bp
Locus ID 10423
UniProt ID O14735
Protein Families Transmembrane
Protein Pathways Glycerophospholipid metabolism, Inositol phosphate metabolism, Metabolic pathways, Phosphatidylinositol signaling system
MW 18.6 kDa
Gene Summary Phosphatidylinositol breakdown products are ubiquitous second messengers that function downstream of many G protein-coupled receptors and tyrosine kinases regulating cell growth, calcium metabolism, and protein kinase C activity. Two enzymes, CDP-diacylglycerol synthase and phosphatidylinositol synthase, are involved in the biosynthesis of phosphatidylinositol. Phosphatidylinositol synthase, a member of the CDP-alcohol phosphatidyl transferase class-I family, is an integral membrane protein found on the cytoplasmic side of the endoplasmic reticulum and the Golgi apparatus. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' end compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...