NDUFB9 (NM_001278646) Human Untagged Clone
CAT#: SC333836
NDUFB9 (untagged) - Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa (NDUFB9), transcript variant 3
CNY 2,950.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | B22; CI-B22; LYRM3; MC1DN24; UQOR22 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC333836 representing NM_001278646.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGAGCCCGGTTTGAAGAACATAAGAATGAAAAGGATATGGCGAAGGCCACCCAGCTGCTGAAGGAG GCCGAGGAAGAATTCTGGTACCGTCAGCATCCACAGCCATACATCTTCCCTGACTCTCCTGGGGGCACC TCCTATGAGAGATACGATTGCTACAAGGTCCCAGAATGGTGCTTAGATGACTGGCATCCTTCTGAGAAG GCAATGTATCCTGATTACTTTGCCAAGAGAGAACAGTGGAAGAAACTGCGGAGGGAAAGCTGGGAACGA GAGGTTAAGCAGCTGCAGGAGGAAACGCCACCTGGTGGTCCTTTAACTGAAGCTTTGCCCCCTGCCCGA AAGGAAGGTGATTTGCCCCCACTGTGGTGGTATATTGTGACCAGACCCCGGGAGCGGCCCATGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278646 |
Insert Size | 411 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001278646.1 |
RefSeq Size | 733 bp |
RefSeq ORF | 411 bp |
Locus ID | 4715 |
Protein Pathways | Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
MW | 16.6 kDa |
Gene Summary | The protein encoded by this gene is a subunit of the mitochondrial oxidative phosphorylation complex I (nicotinamide adenine dinucleotide: ubiquinone oxidoreductase). Complex I is localized to the inner mitochondrial membrane and functions to dehydrogenate nicotinamide adenine dinucleotide and to shuttle electrons to coenzyme Q. Complex I deficiency is the most common defect found in oxidative phosphorylation disorders and results in a range of conditions, including lethal neonatal disease, hypertrophic cardiomyopathy, liver disease, and adult-onset neurodegenerative disorders. Pseudogenes of this gene are found on chromosomes five, seven and eight. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015] Transcript Variant: This variant (3) differs in the 5' UTR and uses a downstream start codon compared to variant 1. It encodes isoform 3, which has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235942 | NDUFB9 (myc-DDK-tagged) - Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa (NDUFB9), transcript variant 3 |
CNY 3,990.00 |
|
RG235942 | NDUFB9 (tGFP-tagged) - Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa (NDUFB9), transcript variant 3 |
CNY 4,370.00 |