C11orf51 (ANAPC15) (NM_001278489) Human Untagged Clone

CAT#: SC333676

ANAPC15 (untagged) - Human anaphase promoting complex subunit 15 (ANAPC15), transcript variant 6



  "NM_001278489" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ANAPC15 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms APC15; C11orf51; HSPC020
Vector pCMV6-Entry
Sequence Data
>SC333676 representing NM_001278489.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCCACTTTGTTCCCCTCACTCTTCCCTCGTGTGACTGAGACTCTGTGGTTTAATCTGGATCGACCC
TGTGTGGAAGAGACAGAGCTGCAGCAGCAGGAACAGCAGCATCAGGCCTGGCTCCAAAGCATCGCGGAG
AAAGACAACAACCTGGTTCCTATTGGCAAGCCAGCCTCAGAGCACTATGATGACGAGGAAGAAGAGGAT
GATGAAGATGATGAGGATAGTGAAGAGGACTCAGAGGATGATGAGGATATGCAGGACATGGACGAGATG
AATGACTACAATGAGTCACCGGATGATGGAGAGGTCAATGAGGTGGACATGGAAGGCAACGAACAGGAT
CAGGACCAGTGGATGATCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001278489
Insert Size 366 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278489.1
RefSeq Size 852 bp
RefSeq ORF 366 bp
Locus ID 25906
UniProt ID P60006
MW 14.3 kDa
Gene Summary Component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. In the complex, plays a role in the release of the mitotic checkpoint complex (MCC) from the APC/C: not required for APC/C activity itself, but promotes the turnover of CDC20 and MCC on the APC/C, thereby participating in the responsiveness of the spindle assembly checkpoint. Also required for degradation of CDC20.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (6) differs in the 5' UTR andz uses an alternate in-frame splice junction at the 5' end of the last exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...