SNRPD1 (NM_001291916) Human Untagged Clone

CAT#: SC333386

SNRPD1 (untagged) - Human small nuclear ribonucleoprotein D1 polypeptide 16kDa (SNRPD1), transcript variant 2



  "NM_001291916" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
SNRPD1 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HsT2456; Sm-D1; SMD1; SNRPD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333386 representing NM_001291916.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGCTCGTGAGATTTTTGATGAAATTGAGTCATGAAACTGTAACCATTGAATTGAAGAACGGAACA
CAGGTCCATGGAACAATCACAGACAGTTTACCTCTGGATACACTACTTGTGGATGTTGAACCTAAGGTG
AAATCTAAGAAAAGGGAAGCTGTTGCAGGAAGAGGCAGAGGAAGAGGAAGAGGAAGAGGACGTGGCCGT
GGCAGAGGAAGAGGGGGTCCTAGGCGATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001291916
Insert Size 237 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001291916.1
RefSeq Size 1514 bp
RefSeq ORF 237 bp
Locus ID 6632
UniProt ID P62314
Protein Families Druggable Genome, Stem cell - Pluripotency
Protein Pathways Spliceosome, Systemic lupus erythematosus
MW 8.6 kDa
Gene Summary This gene encodes a small nuclear ribonucleoprotein that belongs to the SNRNP core protein family. The protein may act as a charged protein scaffold to promote SNRNP assembly or strengthen SNRNP-SNRNP interactions through nonspecific electrostatic contacts with RNA. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the 5' end of an exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...