PFKFB1 (NM_001271805) Human Untagged Clone

CAT#: SC333119

PFKFB1 (untagged) - Homo sapiens 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 (PFKFB1), transcript variant 3



  "NM_001271805" in other vectors (2)

CNY 3,900.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PFKFB1 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms F6PK; HL2K; PFRX
Vector pCMV6-Entry
Sequence Data
>SC333119 representing NM_001271805.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAAGAAAAAACCTCTAGAATAAAAGTGTTTAATTTAGGCCAGTATCGACGAGAGGCAGTGAGCTAC
AAGAACTATGAATTCTTTCTTCCAGACAACATGGAAGCCCTGCAAATCAGGAAGCAGTGCGCCCTGGCA
GCCCTGAAGGATGTTCACAACTATCTCAGCCATGAGGAAGGTCATGTTGCGGTTTTTGATGCCACCAAC
ACTACCAGAGAACGACGGTCACTGATCCTGCAGTTTGCAAAAGAACATGGTTACAAGGTGTTTTTCATT
GAGTCCATTTGTAATGACCCTGGCATAATTGCAGAAAACATCAGGCAAGTGAAACTTGGCAGCCCTGAT
TATATAGACTGTGACCGGGAAAAGGTTCTGGAAGACTTTCTAAAGAGAATTGAGTGCTATGAGGTCAAC
TACCAACCCTTGGATGAGGAACTGGACAGCCACCTGTCCTACATCAAGATCTTCGACGTGGGCACACGC
TACATGGTGAACCGAGTGCAGGATCACATCCAGAGCCGCACAGTCTACTACCTCATGAATATCCATGTC
ACACCTCGCTCCATCTACCTTTGCCGACATGGCGAGAGTGAACTCAACATCAGAGGCCGCATCGGAGGT
GACTCTGGCCTCTCAGTTCGCGGCAAGCAGTATGCCTATGCCCTGGCCAACTTCATTCAGTCCCAGGGC
ATCAGCTCCCTGAAGGTGTGGACCAGTCACATGAAGAGGACCATCCAGACAGCTGAGGCCCTGGGTGTC
CCCTATGAGCAGTGGAAGGCCCTGAATGAGATTGATGCGGGTGTCTGTGAGGAGATGACCTATGAAGAA
ATCCAGGAACATTACCCTGAAGAATTTGCACTGCGAGACCAAGATAAATATCGCTACCGCTATCCCAAG
GGAGAGTCCTATGAGGATCTGGTTCAGCGTCTGGAGCCAGTGATAATGGAGCTAGAACGACAGGAGAAT
GTACTGGTGATCTGCCACCAGGCTGTCATGCGGTGCCTCCTGGCCTATTTCCTGGATAAAAGTTCAGAT
GAGCTTCCATATCTCAAGTGCCCTCTGCACACAGTGCTCAAACTCACTCCTGTGGCTTATGGCTGCAAA
GTGGAATCCATCTACCTGAATGTGGAGGCCGTGAACACACACCGGGAGAAGCCTGAGAATGTGGACATC
ACCCGGGAACCTGAGGAAGCCCTGGATACTGTCCCAGCCCACTACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001271805
Insert Size 1221 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001271805.1
RefSeq Size 1591 bp
RefSeq ORF 1221 bp
Locus ID 5207
UniProt ID P16118
Protein Families Druggable Genome
Protein Pathways Fructose and mannose metabolism
MW 47.4 kDa
Gene Summary This gene encodes a member of the family of bifunctional 6-phosphofructo-2-kinase:fructose-2,6-biphosphatase enzymes. The enzyme forms a homodimer that catalyzes both the synthesis and degradation of fructose-2,6-biphosphate using independent catalytic domains. Fructose-2,6-biphosphate is an activator of the glycolysis pathway and an inhibitor of the gluconeogenesis pathway. Consequently, regulating fructose-2,6-biphosphate levels through the activity of this enzyme is thought to regulate glucose homeostasis. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2012]
Transcript Variant: This variant (3) lacks two 5' exons and contains an alternate 5' exon, compared to variant 1. The resulting isoform (3) has a distinct N-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...