Spermine synthase (SMS) (NM_001258423) Human Untagged Clone

CAT#: SC332702

SMS (untagged) - Homo sapiens spermine synthase (SMS), transcript variant 2



  "NM_001258423" in other vectors (2)

CNY 3,040.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
SMS (Spermine synthase) mouse monoclonal antibody, clone OTI3C9 (formerly 3C9)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MRSR; SPMSY; SpS; SRS
Vector pCMV6-Entry
Sequence Data
>SC332702 representing NM_001258423.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCAGCAGCACGGCACAGCACGCTCGACTTCATGCTCGGCGCCAAAGCTGATGGTGAGACCATTCTA
AAAGGCCTCCAGTCCATTTTCCAGGAGCAGGGGATGGCGGAGTCGGTGCACACCTGGCAGGACCATGGC
TATTTAGCAACCTACACAAACAAGAACGGCAGATTACCACCCATAGTGCGAGGAGGAGCCATCGACAGA
TACTGGCCCACCGCCGACGGGCGCCTGGTTGAATATGACATAGATGAAGTGGTATATGACGAAGATTCA
CCTTATCAAAATATAAAAATTCTACACTCGAAGCAGTTTGGAAATATTCTCATCCTTAGTGGGGATGTT
AATTTGGCAGAGAGTGATTTGGCATATACCCGGGCCATCATGGGCAGTGGCAAAGAAGATTACACTGGC
AAAGATGTACTCATTCTGGGAGGTGGAGACGGAGGCATATTGTGTGAAATAGTCAAACTAAAACCAAAG
ATGGTCACTATGGTAGAGATTGACCAAATGGTGATTGATGGGTGTAAGAAATACATGCGAAAAACGTGT
GGCGATGTCTTAGACAATCTTAAAGGAGACTGCTATCAGGTTCTAATAGAAGACTGTATCCCGGTACTG
AAGAGGTACGCCAAAGAAGGGAGAGAATTTGATTATGTGATTAATGATTTGACAGCTGTTCCAATCTCC
ACGTCTCCAGAAGAAGATTCCACATGGGAGTTTCTCAGACTGATTCTTGACCTCTCAATGAAAGTGTTG
AAACAGGATGGGAAATATTTTACACAGGGGAACTGTGTCAATCTGACAGAAGCACTGTCGCTCTATGAA
GAACAGCTGGGGCGCCTGTATTGTCCTGTGGAATTTTCAAAGGAGATCGTCTGTGTCCCTTCATACTTG
GAATTGTGGGTATTTTACACTGTTTGGAAGAAAGCTAAACCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001258423
Insert Size 942 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001258423.1
RefSeq Size 1680 bp
RefSeq ORF 942 bp
Locus ID 6611
UniProt ID P52788
Protein Pathways Arginine and proline metabolism, beta-Alanine metabolism, Cysteine and methionine metabolism, Glutathione metabolism, Metabolic pathways
MW 35.3 kDa
Gene Summary This gene encodes a protein belonging to the spermidine/spermin synthase family and catalyzes the production of spermine from spermidine. Pseudogenes of this gene are located on chromosomes 1, 5, 6 and X. Mutations in this gene cause an X-linked intellectual disability called Snyder-Robinson Syndrome (SRS). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2017]
Transcript Variant: This variant (2) lacks two alternate in-frame exons compared to variant 1. The resulting protein (isoform 2) is shorter compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...